Description :
From Genome Similarity Track
Location :
Scaffold_136:609- 2659
Transcript NameFunction/comments
Phyke_g4793reverse transcriptase

Sequence
2050 bases(100 bases per row)
CCAGTAGGGGCGGGGATTCATACTAGTGAAGACCGGAGTCATCACGACGGGTACGCGGGTGGCGCGCACAATGATGGCTTAGTCCCGGAGAGACTGTGTT
CTCTCCACACGGAGGAGGGCGGTGGAGGCCTGCTAGTGGTACACATGAGTGTACAGGGATACAATCACCCCTTGAGAGTGTTGATCGACCCTGGAGCCTT
GAAGAACTTTGCTCGACGGCAATGCGTTGCGAGCAATAGTAACAAGTTCTCTGATGCTCTACGCGAGCGTGAAGGGAACGGACTGGTCTAAGTAAGGCTA
GCCGATGGTACAGTGGTAAGAGTACCGAAGGTTCGTGTGAACCTAGTTGTCAAGTTCGAGGACTTTGACAGCGTCGAGCCGTTCATGGCCCTTGACATGG
ACAAGTATGACTTGATTCTGGGCATGCCGTGGCTTGAGGAGCACGAACCCTGGATAGACTGGCGTGGAAAAGCCATAGGAGCGAGTAAGACTCTGGTCTC
TGACAGAGCTTTGATAAGTCATGTTCCCACCTCTACCAGATGACATGGCATTCGTAAGGATGGATGAGACGTACATGGGCGTTGTCGAGGCAGTTGCCGA
CAGCAGAGAAGTAGTTGCAGTGGGCGCTGCAACAGGTCGCAAGACCTCGTCTATCGTGAGATTTGTTCACGGGCCATCAGAGGCTAGGTCGATGGACGGG
ACTTCTAGCCATGCGTACGAAGCGTAAGGCCATAAGATCAAGACTCAGAAAGAGTCCGAGGCGGAGACTACCACGTCGGTAGATCTCTGCATTCAATGCC
ATCGCGCCGCACAAGCTTCAACAGTGACCGTACCGACGGACACGCGTCAAGTGGGTAGCATAGTCCCACACAGTGCGAGTAATACAGTTCCGCATGGAGT
TCCGTGAACTCCTAAGGCTGGCGCCATGGCAGTGTCATCGGGCGTAAGTAACAGAGTACCACGTCCCgaaaagcagcacaagacTGCGAAGGGTCTGGTG
GAATACCAGCCCAATATCGATGCAATCGATCTGGAGCCCTTAGCCCAGGCTCCATCAACACGACCAGTCGAGGAGTGTCATCACATTCTTGATGGAGTGA
CAGTTCTACGTGTCAAGGCAGAAGGTGCCACTTGGAGCCACTGCCCGAGGTGTCAGGGTCGTTGAACCTCGAGAAGTTGTCgttcaacaacttcttggCG
GATCTCGGAGTTGGTGCTCATACGTTCTGAGCCCACTCCTGAAGAGGTGAATTCTTCCTCTGTCATGGACAAGGACATCCTGGAAGAGATTCGCAAGCGG
CACGCTCTGGTTCTGAGATGATCAAGAATCCGAAGGATCCTGTATATCCTTTGCTGAAGGAATTCGGAGACATAGTATCGAAGAATCCACCGTCCCGACT
CCCTCCAGATCGAGGGGTCCGGTATGCGATCGACCTCGTGCCTGGCATCAAGTATTGTGTCACGCGACAGTGACCACTGTCACGTGAACAGTGCGAGGTC
GTTGATGCCTTCTTTACCGCGAAGGCAAAGGCAGGTATGGTACGGGAGTCTAAGTCCCCACACTCGACGCCTACCTTTTGTGTTCGTAAACCGAACGGAA
AGTGGCGTCTTACAGCAAGCTGAACAGTGCGACGGTACCGACTCAGACGCCCATATCTCGCAAGGATACTCTCTCGAACAACATGGCAGGCTGTACGCTG
TTCAGTGCCTTGGATCTATTGGATGGGTACTATCAGATCCTAATGCGCGAAAGTGACATTCCGCCCACAGCAGTGAGCACTCCAAGCAGTATGTTTTGGG
AGTGGCTCGTGGTGCCACAAGGGCTATCAAATGCTCCGACGATGTCCAATCGCCTGGTCACACGGTTGTTCCGGCCTTTGTGTGCGTTCACGCAGACGTA
CTTTAACGATATCTTCGTTCACAGCCGTGCCGAAGGGAGCAAGACGGCTATTGAGGTGCAGTTGCAGTATCTCCGTCAAGTGTTGGAGGTTATGAGAGTC
AATAAGCTCTATGCCAACATTGACAAGTGCGCCTTTGTGACAGAGGAAAT