Description :
From Genome Similarity Track
Location :
Scaffold_713:6089- 8030
Transcript NameFunction/comments
Physo_145250hypothetical protein

Sequence
1941 bases(100 bases per row)
AACAATTCAATCACTTTCGAATCTTCATTCTACCCCTCAAGTGCCTTCGCTCCGGTCCCGCCGTCTGCGACGTCCCTCCCTCCGCTTCGTCCGAGCTTCG
TGTCCTAGATCCATACCTTCCATCACAGTTGATGCAGATTGTGTCTACGCATTCGTGGGCGAAAGCAAACGGCCGAACGACAAGGACAAGGAATGTGTGA
AAACGACGGAAAATGAAAAGGAGAGAGGGGCAACCCTCGGTGGAGGTGTAACAAGTGAAATGAATGATGATGAAGATGATGAAGATGGCACCGAGGCTTA
GGTCTCAAGTGCGGTGCAAGAAGGACGCCCTGGCCGAACGCCCAGTGGGTGACGAAGTTACTCCCAGGCGAGAGGTTGGGGTGTTGGTCCGCGCAGAAGT
TCGACAAGAGAGCTCGGATGAGAGCTCTGGTCAAGGGCGCGGTGAATGACACGCGAACGAGGATTCTATTGGACACTGGCGCGAATGTTAGTGTGATCTC
CGAACGGTTCGCGAAGCAGTTGCGGTTGCGTGATATCCAAGGTCACGGCCGCTGTATGGAAGTTAAGGTTTTTACGAAAGAAACCATGACAACCGAGAGA
CGAACTCTCGTGAAAGTAACCCTCGGCTGGAGCAGAGTGTACAAATTCGAATTGTGGCTTATGGATCATGGTGCTGGCGTGGATGTAGTCCTCGGCACCG
ACTTCATGATTCCTGCAGGAGTGCGCTTGGACTTGTTCCACGCGACCGCGAGGTTGCCGGACGAGGTGAGTATTCCACTCATTAAGACGCTGAACATGCT
GAATGACCAAGTTGAAGGCCCGCACGTCAACGGTGGTCCGTCCGAGGACCTAACCATTGAGTGCCGAGAGTTCGCAGAGTACAGAGTACCGAGGCGTCAA
CCACCTCTGGATACACACGATGTGTGGGTACGTCGCACAAAGTCTCTGTTGCCTACGGTAACGAAGTTTCGGCGAGGCAAGTGTTGTCAAGACTGATGTG
ACGACGCCTCGCCAAGCGACCGTGTGACGCGAACATCAGTGAGGTCGGCGTGACCTTCACTGCGTTGTACCGCAATCATTCAGGTGATTACGGGACGATG
ATTACGTCACGGTGATTACGCCAAGATTGTGGGTACAAGATGGGCATCGACGTGGTGTTCTCTGATTGGATAAGGTAACTGTGTATCCAGTAGAGAATCC
AGTAGGGTGTATCCAGTAAGAGGTATCCAGTAGCAGGCTTAGAGGTAGCACGCGGTTGCGAACTAAGGACCTGAATCGAATCACTTTGCATTTTGCCAAC
TACTGCTCAAGTGTTCTTCGTTTTGGTTATGAGCCCAAGCCCCGTCTTCCCTGACCAAGACCCCGACTACGCCTTCGCCATGGACGCCGCCCCGACCGCG
ACCGCCCGCATCAACAAGTTCGACGGAACCAACTTCCACACATGGAAGTTCAAGATGCAGATGGTGCTGGAGGAGCGCGAACTGTGGGAAGTGACGAGTG
GGGAAGTGAAGCTCGAGCAGTGCACGACCGCGGCAGACCAAGCGACGTTTCGCAAGAAGTCGCGCAAGGCGCTGGCGATCGTCTGTCTCGCGTTGGAGGA
CTCGCAGCTGCCGCTGGTGCGGTCGGCGAAGGACGCGCATGATGCATGGTCAAGACTCGAGGGACACTTCGAGAAGAAGAGCCTGGCGAACAAGCTCTTT
CTTCGTCGACGGTTCTTCACGACAACGATGGACGAAGGTGATGATGTGCTGGAGCACATTAACAAGCTCAAGACGCTGGCGGAACAGCTCGACGCGGTCG
GCGCTCCGGTCAGCGAGGACGACTTGGTGATCACGCTTCTTGCCAGTCTGAGCGAGTCGTACCAGTTCCTCATCACGGCGTTGGAATCGCGTTCCGACAC
GCTGACGTGGGAGCTCGTGACGTCTCGGCTCCTGCACGAGG