Description :
From Genome Similarity Track
Location :
Scaffold_7:60872- 62558
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_02722myosin-like protein

Sequence
1686 bases(100 bases per row)
AACCAGAGCATCCTCGTGTCGGGCGAGTCGGGCGCCGGGAAGACCGAGACGACCAAGTTCATCATGAAGTACCTCGCCGCGGTCTCGCAGAACAAGAGCA
TGCGCAACATCAACGTCGGCCAGAACGACGTGATGAGCCAAGTGCTCTCGTCCAACCCGATCCTCGAAGCCTTTGGCAACGCCCGGACAATCCGCAACGA
CAATTCGTCCCGCTTTGGCAAGTTTATCCAGATGCAGTTTGATCATTACGGCGTCCTCATTGGCGCGTCGATCCAAGTGTACCTCCTCGAGAGCATCCGC
GTCACGTCCCAGTCGCCCAACGAGCGCAATTACCACGTGTTTTACGAGCTCCTCGCGGGCGCGTCGGCCGCCGAGAAGGCGCAATTCGCCCTCGGAAAGC
CCAAGGACTTTTACTACCTCAACCAAAGCGACTGCATCAAGCGCAAGGACGGCGTCGACGACGTCAAGCAGTTTGCGCTGCTCAAGGAGGCCATGGAGAC
CATGCAGTTTGAGGACGATGCCGTCGCCAGCATTGTCTTTACGGTCGCGACGGTCTTGCACATGGGCAACCTCGCCTTCCAGTCCAAGCGATCGGGCCAT
GACGAAGGCTCGATGCTCTTTGAGGACGACGACCGCGTCACCACGGCCGTGGGCCAAGTCATGGCGTACCTCGAGGTGGATCGAGCGTCGCTGGAAGTCG
CACTCTGCACACGCAAGATTACGACCCGCGACGAGACGTACTCGATCGGCCTCCAGCCCGAGGTCGCGGACCAGAACCGCGACGCGCTCTCGCGGTATGT
GTACGGGAAGCTCTTCAATTGGCTCGTCAAGCAGATCAATGCGACCATCGACCACGACGAAGACGGCGACCTCGCGGGCTTCATCGGTGTTCTCGATATC
TTTGGGTTCGAAGACCTTTTGACCAACTCGTTTGAGCAGCTCTGCATCAACTACGCCAACGAGACGCTCCAAGAGCATTTCAACGCGACGGTCCTCGCCC
AAGAGCAGCAGCAGTACGAGCGCGAGAAGATTGCGTGGAGCTTCGTCAACTTTCCGAGCAACCGCCCGTGCCTCGAGCTCCTCGACACCAAGCCCGTCGG
CGTCTTCCACATGCTCGACGAAGAGTGCATCTTGCCCCAAGGCAACGACCAGAACTTTGCGCGGAAGCTGTATAAGACCCACGAAGCGTCCAAGTACCTC
CGTGCCAACAACACAGAGAAGGCCAACCACATCTTTGCGATCCAGCACTATGCGGGCTGGGTTGCGTACGAGACGTACGGCTTTTGCGAGAAAAATAAGG
ACACGCTGCACTCGGAGCTCGCGCTCTTGGTCAAGCACTCGGGCAACGCGTTCTTGCGCACCCTTGTGAAGGACGAGACGCCGGCGCCGACGACGGCCAA
GCACAACAAGCAGCGACAAGGCGGCATTCTAAAGAAGGGCGCGGCCGCCAAGACAAGCGTCGGGACACACTTTCGCACGCAGCTGCGGTCGCTCATGACG
ACGATCCAGAGCACGTCGTGCTCGTACGTGCGCTGCTTGAAGCCCAACGACAAGAACACAAAAGGCCTCTTCAACGCGCAGCGCATTTGCGACCAGCTCA
AGGCCGGCGGCGTCCTCGAAGCGGTCCGCGTCAACCGCGCCGGGTACCCTGTCCGCATCACGCACGCGCAGTTTATCAAGCGGTAC