Description :
From Genome Similarity Track
Location :
Scaffold_19:60872- 62512
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007712Similar to TIF3H1: Eukaryotic translation initiation factor 3 subunit H (Arabidopsis thaliana)

Sequence
1640 bases(100 bases per row)
TTCTTTGTTACTACAACTCATTTTGTGCATGTAATCCTAGGACACTAGACTGCTCTCTCCCTAGTTTCCTTGTTGTGGAGGTGGGTGTTGCCTGCGAAGG
TGCTTGGCTTTGATCAGGACGGGTTGCACTGACTATGGACGTTCTTGCTGGCGCGGCACCGCGCTGTTCTGGGTACTTGGCTCATCGGGGTGGTTGGGGT
GCACAGGGCACCGCGCTAGGAAATCCGCAACCTCTTTCGAGACTCTCTTACTAAGATCGACGACCATAGAGGGATGACGCGAAGGAGTCGTGTTGGCAGA
TTGGGAGTCGTCCATTGGTATTGTCTTCGATGCAGAGAGAGCGTTGGTGGTTGTGCGGCACTCGAGGCGACAATGAGGAAGCAGAGGCACTTGAGACCGC
ACCAGCAAAAATTGAAATGAGAAGCGCTTGTCGGCTGCACTCACTCCCTGAATTCCCTAGTGTTGCACCTCCTGATCGATCGAGACTGGACCGCCACGGC
AGAGGAAGTTCACAGAGTAGGTCAGTGTGCGCAACACACTGCAATCTCTACTGGAGATTCTCCACCCAGGTACGGTCGAGCACATTAGAAACGTGAGTTT
GACGGCAAAGAAGCAAACGGAGAAGTCCTTAAGGCAAAAAAAGCTAATTCGCATTGACAAGGCCTAGTGCACCATGCAAACATACAGGAGATACATGCAC
CCACCACAGCACACAAACACACATACACACACAGAGTCGCGAAGACAAAGAAAAAAGAAATGAATATTAGAGACAGCGATTTTTTATTGGCGCGGGGTCT
GCACACATCTAGACCGCCAAGGCACCCACCCACAGCGAAGAAAGGCACGAGAGACCATGCGAGCGCCGTGTGACAAAATGCAAACGAAAAAATCTACCTA
CCTGCTAATTCCTGTCCAAACGTCCCAACGACGGCCTCCATGACGCTGCGGTTGATTGGCACTCGTCCTGATGTGCGCGCGTGCATGGATACATGCAAGC
GCCTCGCACATCAGTGAGAAGCTACGCAGCAGCACACTGTCCCCGTCCTCTCTCGTTCTGTGTCGTGGCTTACTGGTCCTTGTGGAACTTCTGGGCCAAG
AAGAGCTTCTGGAACGACTTGCCCGCGTACCGGTTGATGTGTTCGCAGTACGTGTTCATCTGCTTCGTGATCAGGAGCGACTCGAGGCGCGACGGCTGGT
GCACCGACTTGAAAAAGTTTGGGTCCTCCTCCGGCACGAGGTCGTCGTTGTCGTTCTCGCGACGCAGCTTGTTCTCCTCGCGCTGTCGGTTCTGCCACTG
CTGGTACGCGACGCGCTGCTTCTGTAATGCGCGCTCGTAGCCCTGGAATTTATAGTGCTCCTGCGCCAACTCGTCGGCCCAGACGCTGATGTTCTTGAGA
CTGTTCTCCAAGTACGCGTTTGTGGCGAGGTCGAGGCGCTCGAAGCTGTTGGCGCTCACGCTCTCGTTCGACGCCACGAGCTCCTGAAGCCAGCAGTTGA
TCACGTCCGAGTTGTGCACGTTGATCGGCAGCTCGTCAAAGATCGTCGTCGATCGAATGTCCTCCTTCGCAAAGCTACAACATGAAAAAAGCAGAGGCAT
ATCAGTCTCGCGCACTATTGACGAGGCGACGTGCAAGCGA