Description :
From Genome Similarity Track
Location :
Scaffold_61:60869- 86805
Transcript NameFunction/comments
g13897.t1RAW43669.1 Polyribonucleotide nucleotidyltransferase [Phytophthora cactorum
g13898.t1hypothetical protein
g13899.t1hypothetical protein
g13900.t1RAW43711.1 hypothetical protein PC110_g149 [Phytophthora cactorum
g13901.t1RAW43715.1 hypothetical protein PC110_g147 [Phytophthora cactorum
g13902.t1KUF64600.1 hypothetical protein AM587_10016911 [Phytophthora nicotianae
g13903.t1hypothetical protein
g13904.t1RAW43720.1 hypothetical protein PC110_g143 [Phytophthora cactorum
g13905.t1XP_008907639.1 AGC protein kinase, variant 2 [Phytophthora parasitica INRA-310

Sequence
25936 bases(100 bases per row)
TCAGGTCAAATGTTTCTCTTTATTTCTGTTGTGTGGACTCTAAAACACCAAGGAGGAGAGGTGGATCTTCCTTGGTAAAGTAACTACCTACTTGGACTGA
GTGCGCGGGCGACGAGCGGTCTTGGGACGACGCTTAGAAGGTGATGCCGAGCGACGGTGGTGGCCATTGCTCGCACACGTCTCAGAGTCCTCGGAGGAAG
TTGAGGCGTCCTCGCTACCGTCTGCACCCAACAGCACACGACGGGACATTTTGCCGGAAGCACCATCCTGCAGGCACTCGAACTCCATCTCTTGGCCCTC
AGACACCACGTCATTGATATTGCTGATCTTGTCGCGCGATAGCTCCGAAATGTGCACGAAGCCACGCTGGCCATCTGCAGACTCAAGGATTGCTCCAAAG
TCCATCACCTGCGTCACACGCATTGTGTAGCGCTCACCCTTGCGGAAAAAGAACGACCGGCCCTTGCTAGAGCCCTGGTTATCATTGTCACGGCCGTTAT
TGTTGTTGGCATTGCTGTTGTTACCGCGAGGGCCAGCGTTGGCAACACCGGCAAGTTCTGTTTGAATCCACTCGCAAGCTTTCTCCGCGCTTCCGGGTGC
GCCCACGACGCGAACAATTCCTTCGCGGCGATCCACGATGCTCACCGAGACTTCGAAACGCGACTCCAGATCACGAATGTTGCTGCCACCGACACCAATA
AGTGCACCGATCAAGTTCGTGGGAATAACGCATTCCATGCTCACGTTCGGTAGCGAGCTTCCACTAGTCTTCAGGTGCTCACGAGGCTCGGCGAGTTCGT
TGCTCATGCGACGCAGCACGTGCAGGCGCGCCTGCTTGGCTTCACGGAGTCCCTCCTTCAATACCGAAAGCGGCACGCCCCCAGGAAGCTTCACATCCAG
CTGAAGTGCCGTCACACCGACTGTCGTGCCTGCCACCTTGAAGTCCATGTCACCGTAGTGGTCCTCCGATCCAAGGATGTCAGTAACCAACTGGTATTCA
CCCTCTTCGATACGCTTCTCCTGGCCAGCAAAGGGGTCGCCAGCAGTAACCAGGCCAATGGCAATACCAGCCACAGCACGACGAACGGGGACGCCCGCGT
CCATGAGCGCCAATGAGACGCCACATACCGTCGCCATAGACGACGAACCGTCTGAACCAACCACCTCCGACGTCATACGCACAGTGTAGGGGAATTCGGT
CACCGACGGCAGAATAGGCAACACAGCCTTCTCAGCAAGAGCACCGTGGCCGATCATGCGTCGGTTGGTGCCACCCACACGCCCAGTCTCGTTCACGCAG
AAGGGTGGGAACTCGTAGTGCAGCATGGCATGCTTGAGAGACGTAGAAGCATCAGGTTCAGCCTGCTCACGCGCCTCATGCAGAGCACCACGAAGGCGGA
CACCACGTTCGAGAGGTCCCAACGTCACGGAGCACAGCGTCTGTGTTTCACCACGTGCAAACAGCGATGAACCGTGTGCCATTGGCAGCACATCAGCCTC
CATCTCGAGCGGACGCACGATGCGAACCGAACGACCGTCAAGCCGCACGGGTTTGTTCTTCTGACCCTTCGTCTCCTTCGCGATGGTCAGAATGCGCTCA
CGAAGCACACGCTGGAAAGTGTCGTGAGCAGCACGCTGGATGGCAGCATCGTCAATAGGAGGTGAAGCAGCAGCAAAGGTCTGACGCATGCCATTCAGCA
TCTTGCTGTAGACTTCGCGCTCTCCCTGCTGGCGAGCAATCTTACCAGCGCGACCACTTGCAATCAGGTCCTCGGCACCCTTGCGCCCCAGCTCCTCCGC
CTTCGCCCAAACCTCCGGCGGGATGTAGAGCGACGAGTACATACGCTTGCGCTTGCCGTGTTCCGCCGCCAGCTTCTTCTGCTCCTCAATAGCCGGTGCC
ACATGCGCATGCGCTAGGTCCAATGCCTCGTCAAGACGCGCCTCCGTCACTTCATCACCCGAGGCTTCTACCATCACCGCACGCTCAGCAGTACCAGCGT
ACAGCACATCAAGCGTCGCGGCCTCACACTGCGGCGCCGTAGGGTTGGCCACCAGCTGGCCATCCACCTCGACAACACGCACACAACCCACCGGTCCGTT
CCACGGAATGTCGGACATGCCCAGCGCCGCCGACGTTGAGTTGACAGCCACCACGAGCGGGTCGTTGTTCGGGTCGTACGACTGCACCGTGGCCAGCACC
TGCGTATCTTCACAGAAATCGCGCGGGAACAGCGGGCGGATGGCGCGGTCCACCACACGAGACTGCAGCACCTCCTCGTCACTGCCAGTGAACTCGCGGC
GCTTCAGGTTGTCCGGGATGAGGCCTACAGCATACGACTTGACGCGGAAGTCCACCGTGAGCGGCAAGAAGTCCCTTTGCACCACTCCGCCATTGGCCGA
GGGGTTGCCATTGCGGTCACCACTCACGACCGTTGTGAGCAGCACCGTGCGGCCGCACGAGGCCAGCACGGCGCCGTCCGCGAGTTTGGCGAGCTTGCCC
ACAGTGTACAAGGTGTTGTCTAAGCTGCCGACCACCGGCTCCTTCACCTTCTTGGGCTCCGGCGGCTGAGTCTGAGTCTGCTTGGGCTCCAGCTGCTGCT
GCTTGTGCTGGTTCTGCAGCTTGGCGACCTCCTCTTCCTCTGGCGACGGCTTCTTGGCGCCGAACAGCAACTCGCGCAAACCGAAGAACGCGCGCGCCTG
TGGCGCTGCACCAGCGATACGAGGCACGCGTTGGCGAGCTGCAGGGATGGCGGCGCGGCGGGCCACGGCCGCGGCCGGCAGACGACGAGCAGCAGTGGAC
AGCATCTTGGTCAATGTGTGGCTCATGCAGCAATCATTGATTATGCTGTGGTGCACACTAAACCATGTTCTGACACACCACGCGAAACCAGCCAACCGTC
TTTGTTCAGCTATTCGACCAGCACAAAAACTTTCAACATCAAAAACAAAACGCTAGGTTTTTTTAAATCGCAAGGAATTGCACCATCCGTACTGGTCGAA
TAGCTGGTTCCTAGAGAACGAAGTGGACCCACACAATCAAAAAGCTCAGTCCGTCCGCACCAGCAGACCGTACTTGCTCCCCCGCCCTCCCCCCCGTCCT
CCAAGCCTCCAGACTCTTCAGCATGGGCACTCGTGTGTACGTGGGCGGCCTCCCGCGCGACGCCACTTCGCGAGAGATCCAGGACGGCTTCAACCGCTAC
GGCCATGTGTCCAACATTTGGGTGGCGCGTAACCCGCCCGGCTTCGCTTTCGTGGTGAGTTGAGCCCCTTCCCCTGCTGCGCGAGGCCTCGCATGATGGC
CCTGTCCTCCCTCTTTCTTCTACCCCCTCTACCTCTCGGCGGCGACAGTTTTCCAGATCGGCAAGCGGCGGTCGGTGGCAACTTGTGTATGTTTTGTATG
TGGTGTCTAGTACTATACATGTTGGTGTATACGCTACCGCCGCTGCTTCCATCCGGCCCTCGGTGTAAGATGATTGTTGTCCGTCTGCTGCCCGCCGTCT
TCGGTGCTTCCTTCCACTGCCGGAGGGAGAGATAGAGGAGACGTCGCTCTGCCGACGATGGTGGAGCCATCATGCTGCGCCTCGCCTCGCCTCGCGTCTA
TCGCCATCTTCATCTTCGCCTGCAACGAACCAATACCAACCAACGCCTCTCCATCGTCGTCCTCCCCCATGCTGCTGCTCCCCACCTCTACTCTAGGACT
TCGAGGACCCGCGTGACGCTGACGACGCCATTCGCTCCATGGACGGCCGTGACTTCCTCGGCGGACGGTACGCGCTGCTGGGTTAAAGCGACTGTAGTCT
ACAATACATCTAACTCTTGTGCTGTGAGCAGCATTCGTGTCGAGCTTGCTCGTGGTGGCAGCCGCCGTGATGGTGGAGGTCGCGATGGTGGCGGTCGTGA
TGGCGGTGGCCGTCGCGGTGGCGACGACGACCGTGGAGGAAACTTTGGTGGCGGTCGCGACCGTTTTGAGCGTGGTTAGTATACGCTCCAGCCAGTGTCG
TTCTCGTTGGTGGACTGATCAAACGTGTTGCTGTGTGAACAGGCCGCAACCCGCCCCAGCGCACTGACTTCCGTGTGCGCGTGACGGACCTGCCGCGTGA
TGTGGACTGGCGCAACGTTAAGGACTTCCTGCGCACGGGTGGCGAGGTTACCTACTGTAACATCGAGGCCGATGGCTCTGCGTATGTATAACAAACCTTG
GTGGGCTGATATGCTTCTGATCCAGTTACTAATTCTTGTGTTATTTCTTTCGATGCAGTATTGCTGAATTCCAGTCCAAGCAAGACTTGGACGACGCCAT
TAAGAAGCTGGACGACACGGAGTTCCGTGGCAGCTATGTGCGCGTCGCTGCTGAAGGTGGAGACTCTGCCCGCCGCTCACGCTCTCGTTCACCTGCTCGT
GGCCGCTCGCCGAGCCGTCGCTCGCGTTCGCGCTCGCCTGTTGCCCGTAAGGACTCCCCTCGTCGCTCGCGCTCCAGATCAGCGTCGCCTGCCGCTGCCC
ACTCGCCCTCTCCTCGTAAGGAATCGGCTTAAGCTGATGTGGATCGAAGAAGGCTGCAGATCTGCATTGGTGCGTACGCTACGCGGTGAGAGCCGTGAAG
GTCTTTGCTCGCTCACGTGTACAGTGGCTGGCAGCTCGACCAGCTTTGTTTGTTGCCTAGCGTCCCAAGGAAAACAAGCACATTAAACGATGGCAATAGC
TTCCTCTTATCATTTTACCCTAGTGTTAACTCTGTTCTCTAGCGTGCAAATCAATTCGCTGAGTGTCAAAGCCACATACAAAACCAACCTCACCAATCAA
GACTCATTCAATTTTCATGACTGCCTGTAGAGTCCTCAGTGTTAACTCCAAACATCGTCAATGTTGGGAGTTACTGAACTCTCTCCGGTATCTTGATTTC
TGGGATGTCCTGTGAGCTGCACACTGTTCCCTCCCAGCACATGAAACCTGTCAACATCATGGCAATCAAAGCCGAGAAAGCGACTCCGAACGACAACAAG
AAGAGGGAGACCTGCTGATGAAGGTGATGGTATTTGTGACTCCTGTTGCTTTCCTCTGCTTCCACCCCGTGAGCGGACTGCAGCGGGAAGCTGTTACGAG
AGACACCCCTGCCGTGCTCTGCAGGCCAGTCCTCTGCTGATCTCCTCTACAGCGGACCTACCACCTGCCCCCAACGCCGAAAAAGCTTAAGAAGACCGAG
CTTTATTATGCGCCGCACTTGCACGTTGTCACACCCTAAATATCCTTGCGCTGGAGTCCTGTTAGTTATGAGAGATTCATCGTAAGTCAAAGATTCCTGA
TGCCGTGGAAGGGAGCTTTCGATTGCGTACCAGGAGGCAGGGACTGCGTGAGCTTGTCGGCCTTCTCCGTGTCCGTCACGCAGAGCGTGTACAGATACTT
GGAGCAACGGATTTTGAACTTGACCACCTTGTCGCTCTTTTTGATCTTGACCGAGCGGGCATCTTTTCGGCGAGCCTTCTGCAGGAAGTCGCGGATGTCG
GTGATCTGCTTCGGCTGTGGACAACGCAAAGCACACACATCGGACTGTCGTTAGCGGGCTGCGGGTCCATCTCCCTAGCTATCGCCGCATATCGAGACGC
CTCCGTACCATTTTGTTGCGTTGGTCTTCTAAACTTAACTAACAAGCACTAGCACAGTCAACACCAGGCGGAGGCTGCGCACCATACAAAGCGCCTGTCA
CGCGCCTTTGGTTGGCCAGCAGTCTCCTTCCGTAAAAACTATTTACGCTATCGACGCGTAATTACACCCTATTCGTAACCCCTGATGAGGTACGTCGTAA
CTTGTATGTGGCGCACACCACTCGCCGGCACGTTTTTAAACAGAGCGCTACACTTCATCTCACTATGGACGTTTATTTCCTCAGTTGGAAACGTCCATCG
GAGCAGCTCCAGAGTCGAAGATGGCGTCCAACCAGGAATGCCACATCTGCCTGGAGGAGCTGCGTCAAGACCTGGTGGCCGCGCCGTGTGGCCACGTCTT
CCACCACATATGCATCTTGCAGGCGCTGCAGGTGAACACCCAGTGCCCCATCTGCCGCCGCCGTGCGGGCGACGCGGACCTCATCACGCTCTACTTCGAT
GTACCGGGCGATAATGAGGCACCCGTCAGTGAACTGCAGCCGCTAAAGGCCTCGGGGGACAATGTGGAGCTCAGTTCGCGCGTCAACGCACTGATGGAGC
GCATCCAGTGGCAGAACAAGCAGCGCGAAGGCATTTTAGGCGAACTGCAGAGGGTACGCAGCCAGAGTAACCAGTTACTAGCCGACAAGCAGGCTCTCGC
ACAGCGCGTCGGAGCGCTGGAAGGAGCCAAAGTGGAGCTACTGACGAAAGTGGCGAGGTTCCAGATGGAGCTGAGTCGCCAAACGGAAGCTGCAAGGCGC
TCCAGTGTGAACCAGAGCATTGTTAGGTACCTGGAGACGTGCGACGCAACGGCTATGGAGGAGGAAATCCAGAACCCCAGGGAGCTAATTATGGCGCTGA
AGAAGGCGTGCAAGTTCCGTCATGACCAGTATCAGAAGGTGGTGAAAGAGAAGATGAGGCTCAAAGAGATGCTGAAGAACTCCCAGCCACAACCGACAGA
GCATACAGGGAATAGTGCAAGGTCGGGTAAAGCCAAGGTTCGAACAGCGTTCGAGACCAAGCGTGCATATCCAGCAGCAGGTAACGACGGAATGGCGTTC
GGAATTGGCGGCCAGCCGCAGTTGGTGGAGAACAAGAAAAGGAAAATCGACTCGGCGTCAGTGGCATCGAATCCAATGCCACTCATTGACAATGACGATG
ATGTGGGTTTCACACCGCGCTCTGAGTCGGCGGGCTTCCGCGCAAACGCCTACTCGGACGTATCGATCCGTCCGCCTCCGAGTTCACGGCAAACGTTTGG
GCGCAGTAGCTTCAATCCGAACCAGTACGGAGCTTTCAACCTGTCGCCAGCAAGCCAGCCACCCGTGCAGATGGCAGGACTCCAGGCTGCGGTGTGTCGT
CGTGGCTATGATGAAACTGGAAAGCTCACCAACTTTTTCCTTCCATTGGGAAAGGAGAGTGATTCACGGTCCATGCCTCGGACGAAACCCATTCCGAGCA
TGCAAAACCTGCTGAACGCACAAACAAGAACTTCGGGTCAGCAGCAGCGCATGGCGAGCAACGACCGACAGGAATACGCACTAACAAACTGGCTGCGCAA
TAACTGAAGGAGCCGAGGGGAAAGCCCGAGGTCGCAAGAAGGCTCTGAAATTTGCGGTCAGAAAGCCGTGTACAATACGATACTATTTGCAATGTTAGCG
GCCGACGATTGTCGTTCGCCCTTTAAACTTTAAGATATGTTGCTTTTGCTTTAGCGCTTTTCTTGAGAGCTATGGAGTTGGAAACGGAGGTTTGTCAGTG
TTGCTTGCAACGTGGCTTGATGTTCCTTGATAATGTTGATGACCTCAGCGTCTTGGCTTGGGAATTTCTTACCGGAAATTAGACGACGGCAAATTTCCTC
GATAGATAAAAACGAAGTGTCTGGGTTGCTGCATTCCACTTCTACTGATTCAGGTTCAGCTAGTGCTGGGTCAGCGTCGGCCATAGCGGTAGAAGGTTGC
CCAATACTTTCATCTGGCTCACCGACTTTGTCGCTTGCATTTTGCCGTGAAATTGCCACAGTTTTCGATCGCCTCCTTCCAAGAAATGAGAATTCTACTG
GCTCCGGAGGTTGTGGCAAAGGCGAAAGCTGCTTGCAGACACAGTAAAGAAGCGTCGCTAAGTTGGCCAAATTCGCTGATGCCTGCTTGCCAATACTCTT
GGGGCCAATACCTACATTCCAAGGCTGCAAGATGACATGCGGGATCAGGATCCGCACAAGCAGAAAATTGATCACCACTACGTTGAAGCGCAACTGACTA
CCACTTTCAACGGAAACCATTTCCCCACTGCGACCATGCTCATCTGAATCAAGAAGGCTGGTTCCATCAAAATCCATTCTCCTGGTAGCACCGAGGGGGT
CAAACTCGAGACTGCGCCGCTCTTCGTCAAATAGTTGGTACTGGATCGAAGTACATCAGGATCATGGTCAGGTCTGCCAACAACTACAGTGGTTGAAGTT
ACTCAACGTACGCTGGGCGGGAAGTAAACGCCATCCGTAGAAATCCGCTTCCAGAAGTCCATGATGCCAAAAGGGACCTCCTTCTTATCGATCGCTTTGC
CCAGTGATTGCAATACTCCTCTCATGTGCACTTTCAGCTTTAACAACTTCGCTGGATCCACAGCACTATCAATTGGATGCCCGTTACCCGCGAGAGGTAG
CGCTGGTACAGGGGGGCGACGAGCAAGGATGCCACCAAATTTCTTGGCAAAACCTCGCAAACTTGACCCCGCAAGACCATTTTTCGTGCTGATGTCCACG
TCTACACTTGGATCCTGAATCAGTGAAAGCAATGGAGTTCTTACCACCTTTCCAAGCCACATGCGAGTGGCGTCAAAGTACACACGTAGCATCGCCTCAA
AGTCCTGAGCAGATTTCGTCAGAGGAAGAGTGAGATGTTAAAACCTTAAACGGTATGTGTTGTGAGCATACCCGGATTGCGCTCTCCTTTTCAGCCATTT
TCTTGTTCATCAACAATTTTTTTAGACACAATGTGTACATGACAGCACGTACAGCGGATCGGAAGATTTGAAGAGGTTCCATCGCTTCAGCATCTTGGAA
CCCGAAGGGTGACACCTCATCGCTTTCAGCTTCAGACTCTAGACGCCAGCGTGGTTTTCGTAGAGCGCCGCTGCTTGCGTTTTTAAGAGAAGCATTTAGC
AGTGCCTCCAATCTCTTACGGCTCTCAAGGCGCTCTCGTGCTTTTTGCTCGTTTGAGGTGCTGGTGTTCGCACTCACTGTGTTTGCAGTTGCATCACTTT
CCTTTGCATTGTTACTGCTACCAACCACATCACTTCCTGTAGCGATATCCTCATCGTTTTCAAGTTTACCCAGGGTCTAAGCAAAAAGTGGTTAGTATGG
TGAGCAAGAGGCAATTGGATCAGAGGCGCACCATTTCATCTTCATCCGTCCATTCAAACTCGGGAAGCCATGACAGAGGAGATGGAGTTTGCAACGTTGA
AGAAACTTTCCTACTTAGAGATGCGCTGTGTGATTCTGGCTGTATTGTTGGGGTAGATGGCTCCTGCGCGTCAGTAAACTGCATCCATTTAGTCTGTGCG
TTAGCGTTTTCCTTTGTGGGGGAATTAGGAGACAGTGGCGGTTTGAATGGTCTCTCCGTGCTCAAAACATTATCAGCATCACTTCCACGCATTAAACCCA
ACAAATCAGCAAGTCATGATAAGCATTACGCACAGTAGAAGAAATGAACATATACACGTACTGCCTTCGCGGAAGTAACAGTGCCATGATCTGTTCGTTT
TGGTGCACCAGTCTCTCAATAAGGCGCTCACTTGACTCGGGGAAGCGCTGATCAAATCGTGTTATAGGTGATGTTTCGAGTGCCCCTCCAAAACCGAGAC
GAGGAGAACCTCTTTGTACTGGATTACGTGTAGATGCCTTGAGCTTGAAATCAGCAGTTTATTGAGCACAACAGACCTTCAACACATGCAAGACTGTGTC
AAGCTGTCCTCACCTCATACTGGTCAACCTGCATCTCAAGCCGCTTCACTTGAGCTCTGTCGAACATGTCAACACGACAATATCTTGCCTCAGATAAAAT
TCTGTGCCAGATACGATAAGCAAAGCCAGAATCAGTACCTCAACTCTTCCCGGCGTTCTTTGCGAGCCGCGATGAGTTGTTGCTGACGCATTCGCAGCAA
TTCATCCTTTACCCCCTCTTGACGAAGAGAAAGTGCCATGCATTGTGGCGCAACTTGATGTAGCGAGTACATGTCACTCCTTGGTCCGGCGTGGGGCATG
CCCACGAAATCGGGAGTTGTCTGTCTTTTTTTGGATGCATCATAAATGGCTCATAGACAGACAACTCAACTCGTGAACGATCAGACGTGAGACGAACAGC
GAAATCTGTGTATTTCTCCGCTGGAATGTTTCTTGATCAACTCTCCGCTGTCACTTGGTCCTGCTTATCAAGAGTATCAGTAGTGACAGGTTTGTCAGCT
TCAGTGGCATTCTTCTGCTCCTCCTTCTGTTTGCCATTGGCTTCTTGTTTTGCGATCTCCTTGCGTGCCGCTTCTTCTCGCCCGAGAAAATCGTTAGTCA
AAGACTGCTGCAAGTCCTCGATTTCGTGGAAGACCTCCAGTGATTTCTCCAGGATCAGCGTAGCAGACTCCAGCGTGTTCTTTGATGCCTCTAAAGTCAT
GTTGGTAAACAACGTGTTTGCTTTGAAAGAACCTTTCGCCATCGTTGCCTGGACACCACGGATCTGGAACATGAATGCGGCAGACAAATGGGGTGCATGT
AAATACAAATAGTGTAGCAGGGCAAAGAGCAAGCAGCATATCGACATCTAATGCTGTTACCTGATCTGACAAATCCCGCACTCGCTTTGAGATATCCCCG
TAGCGGCATTTCATCTTGCCACAAATCACAGGCAGTGAAGCCTCCGCATCACTGATGTCCACCACGCCGGGAGTATGAATTCCTTGCGCTGCAACACGAT
CTTCCTCCGGAACAAAGGTAAGCAGCGACGCCTTGAACGTGCACATGCCCGTTTTCTTCAGTCCATACAACTTCGTGTCCGATTCCGGATTGCTGGAAGG
AATAAGCTCCACAGTCATGGAGTAGTGATCGTTGTCCATACACTCGTCTCCGTCGTCATAGATCATGTATTTGTAATTCATCGTGATTGGATCAATGTGC
CAGCCGCGGAAAATCCTACAAACACATGGAGCATTCAATCAGCGCTTCTCCTTCCATTTGCCAATGACCTTCAAGTCTACCTTACCCGAGAATAGTGGGA
ATTTCCGGTTTCTCTTTCTCCTCTGACACTGGTTCTTCCAGCTTCGCAGATGAATCTCCGTCCTCAGTCGTGTCCGGCACGTCCGCAACCACTTCCACCT
CCACCTCGACTTTCTCCTCAATCTTGGCCTGGATTGTCACATTTGCTAGGTGGCAGAAATCTAGAGTATAGCTGCAATAGCGTTAGATGGGTTGGAGTCT
CTTGTAAAATAGCGTTGCGAAGAGCGTTCTGCCTACGCTTTGCCCTGCTGCATCTCCCTCTCCTCGCGAACGCACGGCAGCGACTCGAGTTCATCAACAA
ATGGTCCTGCCTCACGTAACATAAGAGGAAGGACGCGCTACACGTTAGATATTTTACATTATTTCACACTTCGTCGCATCGCAGACTCGCCTTGGAATGC
GGGAAGTGGATCGCGGGACGGCACCGGCAGCAGCACTTGCGGCACCTCCTCTTCTGGGCGCGGGCGCGGGACAATCCGGATGTCGACCTTGGGCGCTCCT
GTGCACAGCGTGCTGCTTAACGCCACGACGGCCATCGCACCGGCGAACACGCTCCTGCCCCGCATACTCGTCGCTAGCTTGGCAATAATTGCAATAAATG
TGTTTTCGCAGGGTTACTTCGTATGTTACATTTCGTCGGGTATGTTATGATACAGGTTGTATAACTATTGACGGGGATTTCGCGAGTTGAAGATGTGGAG
TGATGGTCATCAAGTTTCGTGCGGAATGCGCCGCTCAGTGCGGAATTTGCCGTGTCGTGAGCAAGCGACCGAGTGAAGATGCAGGAAGACGGCGCCGCGG
CGATTATGAGCGGCGTGCACCGGGCGATAGAGCTCCTCGCCCGCGCTGCAGAAGCCTTGACGGCTTCATATGACAGTCACCAAGTTTCCTCGACGGATAT
TGATGCCTTGAAGCAAGTACTCGAAGAGCTTCAACGCCTCATCCTCGAAGTTGGATCGCAGCGTGTACTGGAGCTGTCGGGGGCGCAGTTGATGAACGCT
GGCGTAGAGTTGTACAACGCGCCTCGAGCTGCTCTTCGAGCTCTTGAGCAAGTAGAGAAATCCAAGACGAAAACCGACTCAGAAGCTACGAGCTTACCAC
GGTATTTGTTAGCGGTCACGCGATTTGTAGCTGCGAAGGTCATGGAACTCTCATTGGTTTGCTCCAAGAACGGCGGTGGTCAGGAAAATGGAGCGAGGAA
AAACACGCAGTTCATGGATGAGTGTGTCGACGTGCTGCGCTCGTTTGGACGAGTGGGAATGTTCTTGTTGGAGAGCGCATCAGTTGACTGTGAAAACTGC
GAAGCGTATTTGGAGCTGGCAAATGAGGCCTTTTCTTCTTCGATGAAGCTCTGGTCTCGTATTGGCCTCGCTCATTTGACAAAATTTAAGCAAGGCGTGG
AGCTGGACGATGTTGTGGATGATTTGTGGGACTTTTGTACCCATCACGTACGCGTGCTCCAGCTGATTTCACAGCGGCCTGACAATTCAGCAGGAGAGGC
TCGAGATATTGTGTCATTGCTGAATGAGTTGAAGATGCTCGCTCCGTACAAACCTTCGTATGCCAGCAGCTTGCTTGATCTCATGCGCAGTGTTAGTGAT
GAATACAGTCAAACAGCGCAGCACGAACTGCAGGTGGTTTTTGCCGAGGAAGCGCTGCGTGTGAGTGAATCGCTTGAAAATGATGCAGACGAAAACTTTT
CGGAGCTGGTTACGTCGTTCAAACAGCATGTGTTGCTGAATTTGATGCAATCTCTCTGCGCTAATAATGACATCGAGCGAGCAGAAGCGTGTTACCAACT
CATTCCAGTTAATCGGAACTCCAAGGTCCTTCTACCCATGATTAAGCTCTACGTCGACAACGAACATTTTGATAAAGCACATCGCCTACTGCTGTCGTTG
TTTCAACAAGACAACTTTGACGATTCCATCTTGGGAGCACGCACATACGCCCAGGGGCTGTCTTTCTCGATCAAAGGAATGGATATTTATCGACACCTAG
CCATAAACTACGGGGATTGCGCGCATGCCATCAATGTGGAGATCGCATGCAATCTTGCTGTGGAAGAGAGCAACCGATACCGAGCGATGTCAGAACTCAA
ACGCATTGGCCTCGAATTGCTCGAGATGGAACGGTAAGAAACCATTGGGTAATCAGACCGGAATATAACGTCTCACTTTTAATTGCATATTACAGCCTAG
GTGAAAGTGGTGATAACAGACTTGTCCAGCGGGTTCAACAAACCATTTTTGATGCTCTTCAACTCGCACTTAATTCCAACCAACACGAGGTAACGAATCA
ATAATGGTGTGCAGCGCGGCCAAATCGACTCAGTTTCCAGCTTGTAGGACTGTTTGAAGTGGGCGGATGCGGGATTGGCTTCGGCGTCATCAGCTGATGA
TAAAGCGACGTACATGAGGTAACATTGATTTAGAATGCGTGACCACTACATCAAACATTGATGAAAGTAATGCTCTGTAGGACGATGTCGCGTTCTTGCC
TCCAGTTGGAACGCTATACTGAAGCTGGGGAGTGGGCAGAGAAGGCGTTTGCTGAAGAGCCTTCTAAGCAATCTCTATTCACTGTTTTCCAAGTGGCTCT
ACAAACAAAATCGAGTGCCTCAAATGAAGAGCTGGTTCACATTATGGAGCAACTAAAAGGCAGGGATGATTTTGAGATCGAAGATTTCCTCGCCATGGGA
AAGCTGGCTGATGATCTTAGCCCAGCAAGACAAGATATCGTGATGCACGTTCTCGACGAGATTTGTCGCACGATGATGCAAACTGAGGACTGCCCAGCTA
ATCTGCCCAAGGAAGTCATCCTACAAAATGCAGCGCAGCTAGCATTCAGCACGTTCGCTCAGCGGCAGACTGAGCCAAGCCCTGCTTCAAGTATAATTTC
CTATGGTGAGAAGTTCCTGGTTTATGCCTCTGCATTGCTGCAGTCATCAAGACCGGGTAGCATCGGCAATTTAGGGCCTTCTTCAGTGTTTGAGTGGTTC
TATCGAATGAGGTATGACTCAGGATTTCTTTTTACGAGTTGGAATTGCAAACTCACAGTGGTTTCTTGATGACAGCTTTGACATCGCCAAAACCACCGGA
GACGCCAAGTTCTTTATCGTGGCAGCAGACATTGCACAACGCAGCGACGAGCTGTACGGAGAACAATCCCCACTCAAGCAGCGATGCCAGCTAAGTTTGC
TGGCAACGGTGAGCTCTGACATGAAAAATATAGAGACACTGGGCAAGAGTCAACTCTTGCGGCTTCTTGAAGTGATCGGTCGATTTGAAAGTATCGCTTG
TGGGGACATGTACGCCAGTGCTGATGTGAAGATCTACTTGGTACGAAGTATGTTTTTATGCTTGTAGCAAGAGAAATGCTGTTCACCCTGATGATTTCTT
GTCGACAGGCAAAGTCAGTGATAGCGGTGAAATTGCGGCTCTTTGACGCAAACACGAAAGCAATTCTTGATCTCTGTAAGGCCACAGTGCACAGCGCCAC
TGACCTCATGCAGATTGGAGGTGTGGCAGACGCAGATGATTGCTACCTCTCGCAATTTCGCTTGCACTAACACTGTGTTGAAGATCTAGTGCTGTATGCT
ACAAAGTTCAACGAAGCATCTGAAGTACGGTTTTTTCGGGCTCAACCTGTAGACAATTACACTCACACGGCTTACTTGAGCAGATTCGAAGCAGCTATCG
ATCACTTGCCAGCGAAATATCCAGCTTCGGGTACCGGCTATAATGTGTTCATTCAGCCATGCTATTGAACACAAATTGCTCACCCGAATAACGTATATCG
ATCAAAATGCAGGCTCCAAATGCTGGTCCAAGAGGATTCCATTGACGCGAACAAGCTGTGCTATCTGCTCCGACGGCTCATAACGCTAGCTGAATCGAAG
ACAAAAGCATACGAGTGCTTCGACCAACTGATTCAGTTCATAGACACTTTGGACGTCCCGCTCACTGAAGTCGACATGGAGTGGTTTGTTGTCAAAGCGT
GGAACATCGTAAGTGAGCTTGTTGATCTCGTCCAAAAGAAGTTGTACTTCGAAGTACTAACCTACGCAATATTTGTAGGGTGTGTCCTGCCATCGCAGCA
ATGACGCAGAAGGAGCCCTCCGGTTTACAAGGACTGCTCAGACCATAATGCGTAGGCAGATACACATGAATTTTGGCCATCCAAATTGCAGGCTAACTCG
TGTTCGTTGATTATGTGCAGAGCACAGCGAGTCCCTCGTTGGAAGGTTGGGCAACAACCTAGACGCACAATACCAAACAATGCTACGAATGAGTTCCCTA
CCAAAGATTGGCGGGTAGTCAGCGCGTAGCGCCCTAGCGCCCAACAGGATAGCGACTTTATCGACCGAGGCAAACAGCGTACAATTTACTTCCCCATTGC
TTATGCCTCGTACACGTCAGGCGGAGAGCCATGACTCGATACTCCACCCATGTGCGTCTTTATAGCCTCCATGTAGGTTCGCAGTGTAGGTAGGTCTGTC
GTTTCTTCTTTCTTTAAGACCTTCGAGGCCCACTTGCGCTCTGCATACTCACAAATCTGGAAAAACAAACGTAAGCGACAAGTTCGCAAGGTCAGCGTTC
ACAGTGAGTTCTACAAAACTGGAAAATGATAAAGAGTTAAACCCACCTCTTTGATATCTCGGCACGAATGCTGCGGTGAGACAGTGGCCAGCTGCGAGAG
CTCCTCGCCGGAGAGTTGCTTAGCATAACTGCATAGAATAGGGAACACCAATACACTGCTTATAAGTTGTCTGCCAAACCACAACTTCTTCAGTGCAGAA
GCTTACCGAGAAAACACCGCGCGGCGGGTCTTCTCGTCAGGAAGGTTGTAGCGAATGCAGAGATCAAAGCGACTGATCAATGCGGCATCCAAATCCTGCT
TTCTGCAGCATAAAACAGCAATTACGTTTACAGTTTAGCAACCTCCCGATGCACAGAAGGCATCATCTGAAATTTAACAATGCATATACCGGTTCGTAGC
GCACACAACCGTAGTCTTCTTAGCAGATGCAAAACCTTCCACTTTTTGCAGTAGAACCGACAAAATTCGACGCGAAGCCTCGTGCATTGTGCCACCAGAA
CGGTCTCCGGCAAGGGCGTCAATCTATTGCAGACAGCAATTCATAAAGTATCAGTAATGTTAACGCTGTACTTCAAAGTACACCAATAGACAACCAATGG
GGACACGCACCTCGTCAATGAAAATAATGGCGCCATCGAGTTTCTCGCACGCGTCAAAGATCGCAGACATCTTTTTTTCGCTGTCGCCGTACCACTTGGA
CACCACACTCTCAATTGGGATATGTATCATTGGAATTCCAGCCTGCTGTGCGATGATACGAGCACTCAATGTTTTGCCAGTGCCCGGAGGGCCTTCAAAT
AAAACAGCGCGTGGACGATTGCTTTCGTAGCGGCAACGGGTTTTCTGCGCAATGCGCTCGTAAAGTTCTGGGTTCTGAAGCGCCAGCACAACCGTGTCTT
CGATCTCGAGCTTCACGTCTTCGTATCCAGCCTAACCATACAGAAACATAACCAAGAGTCATAATTGGTAAAGCGCTACTGCTGTTTACCCCTTTTCAAC
AAATGCATACCAGACTCTCCCAGGTTAAACCGATTTCGCTTTCTGTTGGCTCGAAGACATCAATACCTAGCCCTTGAAGCTGCTGGATTGCTTCCTCCTG
CAACCAAAGCGCACCATGTGAGTTACTCAAAGTAGGACTACTAGCAAAAACAACAAGCCAACAACGGACCTTGCTGCCAGGGGTTGCTGTTGTAGCTGTG
GTCGGATTTCTTCCACGTCCAACAAGTGCGTTCCTACGCCGCTGCTCAAGGTCATGACGGAAGAAGGCGTTCACGTTCGTGTACGAGTAAATCTCCTTGT
AGGCACCAACAATAGCGTCGATCTCGCCTTGCGTTAGAAATTCATCCTTGTAGAAAACAAACTTGGATGTCGCTTGCAATGAAGACGAATCACGCAAGAA
CTGGAACGAACCAGAGCCGTTCGTGTACAAGTACGTCACAGCAGGCTGTTCGTAGGCCTCCACCACCGACTTCTTCGCGGTGTTATCTAGCGGCATCACC
TCTACCGACTGCTTGGAGGCAGGCGTCGACGCCTTTTGCAATTGCAGTAAGAAGCGACCAAGGATAGCTTCTTGGTCCACGAACGTCGGACACGCAAACT
CGATCCGGATCGTCGACACGCCGTTGGGCGCGTGAATCTTTGAGATGCCAATCTTCTTGATCGGAAAAGCCTTCGGGATGCGCGTCTCGGAGCTTTTCAG
CGTCGTACGGAACTCCGACACTTGCTGGCGAATGGTATCCACAGCTTCCGCGTACTCAAAGTGCTGCAAACACAGTCACAAATGGAGCATTTAGTCTTCC
TCTCACGATATATCTAATACTTCAATAAAAGGTTCCTCCAACCTTCTCCTGCTTCTTGTCAGGGGCTGCCTCCAATTGTGTCGTGTCCGCATTCACCCCC
ACAACACCAGCGAGAGCTGCAGCAACAGCGAGCACAGCGAATCTATTGGGGCCTGAGTCGCCAAAGGCCGCCACGACGCTCAGAGGCCGCAGCGCTTGGC
TGGAAGGAGCTGCAATGCGACATAGAGAGGCATCCATGGCCACTGGCAGCCGCGTGGACTGGACCACGGCGCGTGCTACGAGCTTGACGGCGAGCCCTCG
CTGCATCCTTTTGTCTCGGATTCTCAAATAGAAGTAAATAGTAATACCTAGGTTTCAGTAAATGCACAAAATTGGGACAAAATGCTATGTTCGAATTGAG
TTTAACAGTGACTCTGATTAGGAAATCGTGCTGTCATTTTTCTTGCGACTTTATCAATTGATACAGGTCGAAGTGACGATCACATATGTAAGGGATTTTA
CGGGTTTACTCACAGGAGGTGCATGTTGTGCGAGGAAAAGCGATATTTGTATTGAATGAGTGAAGGGAAGCAGCGTCACTATTCGTGACTCACTAATGCT
TGACCATCTAGCGACCACCGCGCACAAACACTTTTTTTGGTGGGGTCTCGGCAGCTTTCTGCTCTTCGCCTTCACACCGCTGTCGGAAGGTGGCAAGCTG
TCGTCTAAGGGTGCTGATCGTCTGGGCTTTCTGGGCAAGAATCTGGCGCACGTAAAGCGTCGTCGTTAGCTCTGTAGACGCCATGGCACAGCGCTCAGGT
ACCTACCTCTTCCAGACGCGAAACATACTGCTCAATACTCGCCGAGTCGCCAGTGGCGTCGTTTTGAATAGCTGCTAACATGGCACCTTCCTCTGTGAGT
AGCTCTGCATTTTCCTGGACATATCCATCAATAGCGCATTAGGCACGAAATAGCGCAGTTCTGTTGCAGACAAATAAGAGTAACAAACCTGAATTGCATT
CATGTGTGTGCTGAGCAAACCCTCCTGCTCTTCATACAGAGTCTGAACCTGTAGTCATGCACACACTATTGTCAGCGTTGCTGTCCCTTTCAGCACATAC
AAGTTAGGCAACAAGCTTAGCATTACCACTCCCTGCCACGCTTCCTCTGAATATCCGCTTTCCAAGGCAGAACCACTTCTTTTGTCTGCTTGTACAAACA
GATTAGAGCCATGTAGAGGATAATCGCAAAGATAGCAGCGTACCCGAATGGTGCCGACGACTAATGCGGAGAATGCTCAAGTCGTCGCTCAAGTCGCGCG
TGTGATGCGAGGAAATTGTCACTACATCCCTATTCCCACCATCAGCATCGCTCCTGTACTGATCACCACCGCCTTCGAGCATGTCATTATCATCGTCTTC
TTCTTGACATTCCTCTTCCTCCTCTTCTTCTTGCTGATACCCGTCTTCGTCATCAAACTCCTCAGCATCGTCACTCCCATCTTGGTTGGGATACGCGTCG
TCACCGTCAAGATCTGTTTACGGCACGACGTAACCTCAACATTAATGTTCACCCCATGGTAGCGATTCCACGAGTTCACACGCACCCTCTTCAAATTGGA
CGTCTTCGACACCCACAGCATCAGACTCAGTATTCCTCTCATCAAAGGCATCCGCAGAAACACGCTTCTCTTTGACCCGATCAGCATAGCGAAGAGTATT
GATCGTATGGTCCGAGGACGAGGCACACGGCGAGACAGCGGCAATCATCACCGTCCTATCAAACAGAATTCAATCAGTTGCAAAAGCTGGTTGGTGCTGG
ATATCTTCAACACGACTTACTTCGCTTTGGCATTGACAAACGAATCTTTTAATACTTGGGTGAGCTTGCTTGCTCGAAAAGGGATATGAGTGCCTCGACC
ACCACTATCCAGCGCTCTATTCATCACAAAAATGCAACGCAAATGAAAGGATTAGGAGACAAATCTTAACCGGCCGCCATTTATAACGTACCGAAAGCAC
TCCTTCAAGGCCAGCAAGCTTCGATTGATTTCCGCAGACTCCAATCGTCGCTGCCGATTGTGATTCTTTGTATCTTCACCACGCTCACTACCCGCAAGAT
CGATCAATGACAATTTGCCGTGGAGTTGCCCAGTTGCTTTCTCACGAAGATTGATCTGGCAGATGCAGTGTGATCGTGATGAAACATCATTCATCTCCGT
GGCATGCGTCGTGCGAAGACTGTTGCCTTTGCTGATCACTTGCAGCAGCTCCTCAGTATTCTGCGGTTGCACCTCCTCCAAGTCCACAATCTGCACTTCG
CCTGCGCCATCTTCACGAATCGTCAGCACCTGTCGATGCAACAAATCCTGGCATCGACCACCATAAATCTCAAAGAAGCTCACGCAAATATCCAAAGGAT
ATCCGCGTCTTGCGAAGTCGTCGGCCTGCGCAAACACATCTGCCGCAATCTGGCTCTGGATGCCTTGCATCGTGTGCGTCTTGCCACTACCCGTTTGTCC
GTATGCAAACACCGTAGCATGGCCTCCGTCATGGAACACAAACTTCACGAGCGGTTGAGCTGTGCACATGTACACACTCTCATTCGTCGCATTCTCATCA
AAAGTCTAAAAACAATAAACAATTATCAAACACCAGTCCACAACCTCCATACCTCACCAAAATGCCCCGTACATGGTCGAAATTGAAGGCGTTGCTGTCC
AGATACTTGGTGATACCGTCCACCTTGAGCTTGCAGTAGTGCACGATGGACATGGGGTTGAGACACGTGACGGCGTCGTAGTCGTGCTTCTTGACCTCTT
TGGCGTTCACCGGCCGCTTGCGCACGCAGATGGTGATCTTGGTGTCCCCCGCCTCAGCGTGTGGCCGGCTGCGGTCCTTGTTCTGCTCCCGGAAGGCCTT
GATCATGCGCTGGAAGTCCACGTCGCCCGGGTGGCCCATCTTCTCGTTTAGTTGGCTCTCCCGCTCGCGCTCACGCTTGGCCGCCGCCATAGCGCGTCGT
CGGTCCTCGCGGTTCTTCTCGATCTCGGCGATGGCCTGCATCGTCGGCTTGGTGCGCGGCGTCGTGGAGGGAGCCCCACGGCCGGCGCCACCGCGCGCAT
TACTCGCTCGCCACGCCATCCGTCGTCGGTTAGAAAAATAATCCACCAGCGTAATTATCAGATCCACACTTCAATTTGGAATCAGAACGTCTCAGAAAAA
GTGACTTTTCTGATTCTAGTTGCATTTCAAAATTGACAACTATGGCAAGGCAGGCGACCTCGTCGACGCAGTTGGAGGCGGCGATCGACGCCGTCGCGAG
CGGCGCCATGTCGCTGCGCGAGGCCGCGCGCAAGTTCGACGTGCCCCGAACTACACTGCAGCGCCGTGTGCAGCGCCGCGCGGCGGAGGTACCCGAGTCG
GAGGAGGCGTCAGAGTCTGTGGCGGTCAAGGCGGAGCCTGTCACAGCTGATTGCAACGCCCAGAGCGACACGAGCGGCGAAGAAGCTGCAGAAATTTATA
CTGAGGAGCATGGAAATACTGCAGAGCGTGACCAGAGTAATATTACAGGACGCAAGCGACTCGCAGAGCAAATGGAGACACCGAACCAAGGTGGGCAATT
GGGTAGTAAAGCTATATTGGTTTTAGTGGGGTTTGACCGACTTTGCGCGTGGATTTAGGCCCGCGGAAGGTCATCAATTGCAAGATTCGGATGCTGTGTA
CGGCGGCCGGGAGCGCGTTGGATGAGTTGAGCAACAAGATGATCCGGGAGGGCAAGTGCATCTACAAGTTGGGATTGGGCCAGTCGCCGTTCCCCATCCC
GCAGTGCATTGTTGATGAGCTACGGTGGGTGGAGGTTGTAATTGAATTTGGGATTTGTTGAAGCTGAGCGTGAGTTTGATTGCAGCGCTAACTCGCATCA
GCGGGATTATTTGCCTGTTGCGGGGCTGCCGGAGTTATGTGACGACATTGCTGCGTGGGGGACGGATCGATTGCATATTGACTACTCGCGGGATGACGTC
TTGGTGGGGCCTGGAACTAAAGAGCTGCTGTTCGTCCTACAAACGGTGTATTATGGAGACCTGCTGCTGCCCAACCCGAGTTGTACGAGTTACGCCCCGC
AAGCAGCTATTGCTGGGAGGTGGGTACTTGAATTGTATGGGGTTTGCGCGTACAGTTAGCGAGGCGCAGTCTAACCTAACTCTGCGTAAAGAAACATGAT
GTGGCTGCCAACTCATGCAGAAGATCACTTCGTGCTGCGTCCAGAAGTGCTTGAAGCGCACTGCTCGAAGGATCCAGGTACGTGCAGCTACAGTTAGCTT
ACATCATAGAGCAATCCGAGTTTGCTGACACGGGATTATTATGTAAACCGTCAGACGCCCCGCGGATTCTCATTTTGAACAGCCCGTCAAACCCAACAGG
GTGCGCTTACCAGGCCGACGAGGTTCGTGGTTCTGCCAAGATTTCAGTAGAGCGACGATAATACCCACCTGACGTTGCTTCGTATGTTGTGTTCATTGAT
CATGGCTGACCAGCTGGAGGCACTAGCAAAAGTCGCTAGGAAGTACCGGATTCTCGTTGTATCTGACGAAATCTACTCGGAGCTGCATCATTCCGGCACA
CATCTGTCGCTCTCCAAGTACTACCCAGAAGGAACCATCGTTTCAGGAGGATTGAGCAAATGGTGCGGCGCTGGAGGTTGGCGCATGGGCTTCTGGTTGT
TTCCGCCAAGTATGGGCTGGTTGCGCAGCAGCATGCTCGTTATGGCGTCCGAGACGTACACGTCAGTTGCATCGCCTATCCAACACGCTGCTCGACGGGC
GTTCGTTCTTGAGTAGGCAGCACGATCCAACATCCTCGCGAGAAAGCGACGCCAGACCCCGATTCTAACATGTTGCCTTGTTCTGCGCTGTAGTTGCGTC
GAGCTGGCATCGTACAAACGCAAGTGCCAGAAGACGCTGCAGCTCATCGGCCGCTGGTTCTCGTACCAGCTGCAGAAGATGGACGTCGAAGTGCAGGTCC
CGGAGGCGGGCTTTTATCTGTTCCCATGCTTCCGCCGACACCGCAAGGCGCTCGCGCTGAGAGGCATCTCGACTGACGAGCAGCTGTGCGCGCAGTTGCT
GCAGGATACGGGCGTGGCCATCTTGCCGGGCTCGGCCTTCGGGCGTGCGTCGGAGGAGCTCTTCGCACGACTGGCGTTCGTGGACTTCAAGGGCGACCTC
GCGCTCTATCTCATAGAGAGCATGGTAAGCAATTCCTTCAATGTGAGCCTTTGCCACCGAAAACTCGACTCATTCACCCCTAACGATATTTTGTGCAGCA
AGATGACCCGTCTTTGGAGGCCATCGAGGGCTTCATTCAGTCGGTCTGCCCCAATCTCGATATCGCCATGCGCAAGCTGGCGGCGTGGATGGCTCTTGCG
CGGCCGTCTGCCGCGCCAGCAACGGCCAGCGCCTCAGGCGTCGCCTTCTAACGAGCGAGCAGGTCGTGGGGAAACCGGTGTGCGCTCAATCGGTCGCCAA
CTGCTGCTCGCCGAGGCTGGAATTTTGTCTGGAGGTTGCACGTGAATGGCGCAATGGAGACTCTTGCCAACTCGCCGCTGACGTCACACGAAACCGCGCC
CTGTGACGTGCTGTTTCTTGTCAAACGAGAAGGCATCTTATTCGCAGCATTGCATTGAACCGCTGTCCACGGAAGCCCAGCTGCAGTCGACGGAAGCTCC
GCTGAATTGAAATGAGTTGGTGCCAGTGATGCCACTTTGAGCTTCTGCTCCGGGGCCAGGGCTGGCCACTTCTACATGGCACTGCGCAGCCGATTTGTGG
CGAGAAAGTAGCGCTGCCCGTCCGACCCAACATGGAAGGCCAACACCAACAAAGCCAAGTCCATTCGACCCACCCTGGACGGCCAACACCACCAACAAAT
CCAAGTCGGAGCCATCCACAGGTCCGTGGTGGTTTCGTCCGATCGATTGATTACAGTAGTTCTCGTAAATTACACATACATAGCCTGCAACCCAAGCCTC
GGTACAAAGCCACGAAGAGACGACTGGGGGAAGTTGTCTCGGCATTTCACTTGCTGACTTCTCTCGCCTTCTCGATGCCTGCGGTCGACGAGTACCCGCG
CCGTACGCCGCCCCGGGACGCCGCGGCGCGCTCGCGCTCGGCCGCCGGCAGCGCGCGCGCCCTCAGCGCCTCGTTCCAGCACCAGGTGCAAGTGAGCGGC
AGCAGCAACCTGCGCGCGTCGTACCAGGAGCCGCAGCCTTCCAAGAAGAAGCGCCACAGCAACAGCAAGAAGAGCGCGCAGATGCGTCACTCGCTCACGC
ACGTGCAGGGCTCAGACGCGCAGCGCTCCAGCGCGTCGTCCACGTCCGGATCGGCGCTGTCGCCGCCCCAGCGTGGCTCCAACTACCTCAATCTGCACAC
TACAGGTCGAGAGTTGAGCCCCCGCCAGCAGCTGCACCCGGAGTACCCGGCCGCGCCCCCCGCGGGCGATGACGTTCTCAAAGTAGAGATCCCGCGGTGG
AAGTCGAAGCTCACGACGGACAGGGCCGACAGACTGCACATCCCAGCAGGAGCCGACAGTGCAGGCAACTCGCCCGTGGCCAGCGGAGCAGGCAGATCTT
CGACGTGGAACGGCAAGGACGGACGAGGCGGACACGGGGGCTCCATGGGGGCGCTGGTGCTCGGACGGGACCGAGATAACGGATCCAAGAAGCGCTATAC
GGTCTTCCAGGTGTACGTGCACTTCCAGTCGGGAGCTGTCCGCGTGTCTGAGAAGAGGTACAGCCACTTCCGGGAGCTGCACAAGACGCTGAGGCGGAAA
TACGCAACGGTCGGGAAACTCTACTTCCCGCCCAAGAAGTTCTTCATGTCGCTGTCGCTGCGTGTGATTGAGCAGCGCCGGGAAGCGATTGAGACGTACA
TGAACGCGGTACTGACCCTGCGACCACGGCCGATTGAGGTCGTACAGTTCCTCAGCAGTGGCAGCAGCTCTGTGGACGACGAAGAAGAGGATGGCAACAG
TACGGACGGACAGGCGCGCGGCGTGGATATGGTGACAGCTCCGAAGCACGTGCAGTCCACGTCCACAGCTCTTGGGACGTCTTCGCGGCTCAGCGCCAGC
AACAGTTTTGCCTCGGAGGACGCAGGGAATCATTCCGTGACGATGCAAGACTTTGAGATCCTGAAAATGCTCGGAAAGGGGTCGTTTGGAAAGGTCTACA
TGGCTCGGGAGCGCGGAGGAGACGGTAAGATCTACGCGATGAAAGTGCTGCGCAAGTCGGAGTTAGTGAAACGCAACCAGGTGGGGCACACGATGATGGA
GCGCCGCATCATGAGCTCCATCGACCATCCTTTCATTGTCGGGCTCAAGTACTCGTTCCAGACCGCCAGCAAGCTCGTGATGGTCTCGGACTATTGCTGC
GGAGGCGAGATCTTCTTCCACCTGAAGAAGTTTCGCTCCTTCTCGGAAGCTATGGTGCGCTTTTACGCCGCGGAGTTGGTGGCCGCCATTGGCCACCTGC
ACGAGCGTGACATCATCTACCGCGACCTCAAGCCCGAGAACATTCTTCTTGACGAGACAGGCCATGTGCGACTTACCGACTTTGGCCTCTCCAAAACAGA
CTGCACGGACTTCACAGGCGCCAAGACGTTTTGCGGCACCCCCGAGTACCTGGCACCCGAAATGCTCATTAGCCGCAAGAAGAAGACGGAGTACGGCAAA
GCCATCGACTGGTGGAGCCTTGGGACCCTCATGTACGAGATGCTCACGGGCTGGCCGCCTTTCTTTGATCGCAATATCGAGCAGATGTGCACCAAGATCA
TGAAGTCACCGCTCAAGTTCCCGGCTCACTTCGGTCTGAGCTCTGAAGTCAAAAGCCTCATTTCGGCACTGCTGGAGCGCGATCCGACGTATCGCATCGG
CTCACGCCCCGGTGCTGGCGTGGAAGACATTAAGAACCACGTGTTCTTCTCTAGCATCGACTGGAAGTTGCTAGAGCAGCGCGGCGTCAAACCCCCGTTC
AAGCCGCGTGTGCGCAGCCCGACGGACATCCAGAACTTTGACCGTGAGTTTACGAAGGAATTGCCTGATCATGGTTTCTTGCAGCAGGATAAACGACTTG
CAGTGTCACCCAAGAACGAGTTCCAGGGATTTTCCTACACTCGAACGGAGGAGCCAGCATCAATGTCACGAGAGTCAAGCAGCAAGCGAGAAAAGCGCAG
GTCAGGGCGCCGGTCGGAGCCGCGCCTTAGCGAAGGGTACGTACGAGGAAGGCATTGAAGCAGCGCTGGACGCCGAACTACTCTTCTGGATCTTCGTAGG
GGTGCCTGATTCTCTCTCTCTTGCGTCTTGGGATGGGCCTTGGGTGTTGCTAGAATCGAGCGCGAGTCCCAGTCAGCAGCAGATCAGCAGTATCCCGAAT
TCGGCCTCGTCGGCCGTGACAGCACGGATTTCGACACTGGTTGTATCTAGAGTACGTGGAGGCCACCGCGCTCGTCGTGTCCAGTACAAGAAGGAGGCAG
CAGGTGGGCACCAGGAGCAAGTACATGTGATGATATTCTGTTTCTAATTAAGACTTGGTACAGGTACGGAGCCGATCCGAGTGGAGTCGTTCGCTGGGAG
ACGTGAAGTACGTTGTAAGAAAATGAATGAACCTAA