Description :
From Genome Similarity Track
Location :
Scaffold_86:60842- 65155
Sequence
4313 bases(100 bases per row)
GAGATGGAGTCAGTGGAGGGAGACAACTCCCATGATGAGTTCGATCCAGATGATCTGGATGGCCCATCCCCTTCATCAGCGGTGTTAGCAACAGCCGCAG
CCGGGGCGGGTGGATCGTCCATGATCCAGAGGGCACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCAAGGATCAAGACGAGGACCGAGCGAG
AGCATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCCTAAAAGTGTTTGACCTTTGCGGATCTGCTAGCGGGGCCAGCCAGG
AACAGCTGGGCAGATCCACCAGGAACAAGTGGCCAGATTTGCTGCGCAGTTTCCAGACCCAGTACTGTGGATTGGGAGTGTCGGTGGCACGACAATATTA
CCACGCTCGCCGCAGAGCGGATGAATCCCCGCTAGAATATCTGCATCGACTAAATGTGGCCGGTCTACGGGCCAAGTTGAAGATCAAGGATGGGATATCC
AAGGTACTACGGGAACATGTGGATCATTTCGTCGAGACGTTGGGAGATGTGGATCTGACCGACAGGCTGACCCTGTTACGTCTTCCAGACGCTGATGAAC
TTGAAGAAGTGCCGCGGGCTGTGGATCGCGCGAAACACCGCCAGAAGAAGGCGGCGGTCGGGATCCGGCAAGTATCGCCAAAAAGCTCCGACGCCCACGG
CTCCAGCTCGACGTGTCCACCAAGTCACGGCGACCGACTCAGGAACTGAATCGGGATCCGACGGTTCGGACTCCGACCCCGAGGATTACCGGCCGAGTCT
GTCTCACTGCACCCAACGATCGTACGGCGAAGACCGGAGACAACCCTCGATCGGGGGATACCGTACCTGGGGACCGTGGGATGTACAGATCCCGAGATCT
CATGGACGGGACGGCGCAAATCAGGTGCTCGCAGTGCAGATCCCGGAAGCACACAGAGGCTGGATGTTGGAAGCATCTGGTCTGTGAGAAGTGTGGCAAG
AAAGGTCATCCCGGAGTTCATTGCTTCTACGTGTGTCGTGGTTGTGGCGAGATTCACGACGTCGGCAAGTGTCCGATGGAAGAATTCTACAACCAGATCC
GCCAATGGTTTGATCCAGCCAAGCACAGAGGGATGTTGCCAGAAGCGGCAGAAAAGATGTTGAACTAGGACGCTCGCCGGGTTTGAATCCGGTACGAGCC
GAGCGTTCTAGGTATTGCATTTATGCATTTGTGAACAAGACATCGCTAGATCCAGGTAGCAGGACCCTAGTTCTAGTCGATAATTCACGTGATCTACATG
AAGTTTCAGTTGCCGAGATTTCTAGTTTGCGCCAAGTGGATGAGTTTGCCAGATCCGAAGTCTCTTCAACCTTGGACCTACAAAGGGGAGAGGCACGCGG
TTATTGGGAGAAACGCCAACATGGTCGATGGTTTGAGCCTACCAAGGGTGAGGTCACTGCAGATCCACCCAAGGTTTGTCAGGTTACTGGATCCCGAGAT
CTGAAGATGTTGGATCCATGGATCTGCAGACAGGGGAGTCCCGTGGATACTGGAAGTACCATGCCCCAGCAAAATGGTTCAGACAGGCCAAGATAGGGGG
CAAGATCAACAATGAAAAAGCAATCCTACTCCTAGATAGTGGTGCCGAGGTGTCTATACTAGACACCGCCTTTGCTCGTAAGGCTGGGTGTCAAGTGGAT
GGGAGTCAAATCCAAGATTGTGTTGGGATTGGTGAAGGCGTGTACCGTACGAATGGGAGAACGCGGATCAAGATCACACTGGCAGGTTGTTTGGTATACT
GGTTCGATATTTGGGTCGGAGATCTCGCTGGTCAAGACGCCATCCTCGGGATAAATTTCATGGTACCAGCCGGGGTAAGGTTGGATCTGGCGGATGGGAC
ACTGTGTTTCTCGGACGAGATGCGGATCCAGCTCAACCAACGGCGACCGTTGTACGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTGGATC
GAGCCCGGGGAAACCTGGGAACTGCCAGATCGGCTGAAGTGGGTGGAACATGAGAAACTGTGGGCCACTCGGGGCGAGAAATGGGTGCCTACAGTAATCC
AAGGACCCGGTCGATCACAATACCTCCAGGTCACGAACGTCAGCGACAAGAGACTAATACTGGACCATTATGAGGAGATCGGGCGATGGTTGGCGAAGGA
CGGTATCCCTAGGCGACCTGGATATGTGTCGGTGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGAGTACCGAGATCGAATCTCTC
GGGGCGGGGGAGCTCCCGGCGGAGCCAACTGGCCCCTTGGTTAATCGGCCTTCATACCCAACTCCGCTAAAGATCCTGCAGAGGGATCGTCGGATTGAGA
TCCAAGCGATAGAAGTGGGATCCAAGACATGGGATGATCCCCGGAGCAAGCCCTTAGATAACGCATGGTCGGTGGATGAAGGATCGCAGAGAGCTGAAGC
CGGGTCGCCAGATCCCGCTGACCCCCGAGTGGATCCTAGCTTCCCATGGGACAAAGTGCCTGGATCCTTATCGAGAATGGCAACACTAGACAAACAAGAG
CCGTCGTGTTTAAACTCGCTAGATGATCAAGTCGATCCAACTGCTGGCTTCCCCGGTACCAGGGTACCGGATCCCACGAAAACAGAAGGACTGACAGGTG
AAACAGGGTCGCGGTGCTTGGATCCAATGGTGGATCCGATGAAGATGGAAGATGAACAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGATCT
CGGAGAAGCACTGGCGGTGATCCCGGAGGTACCACTGACCACAGAGGAGGTCACGATTGATGATATCCAAGTGGATCCAGGGGCGAACGAACCCGCGGAA
GTGGATCGGTTACGTCAGAAGATCTGGGAAAGCCGACATCTGCTGATTGGTAAAGGTAATGCATTACCGCCTGCTGCACGTGGAGTCAAATGTGACATCG
ATGTCGGCGACGCGAAACCGACCACTCAAAGGGTGCGGAAAGTGGCACCTCAGTTCCGAGAAAATTTATCGGATTTGATCAAGGGCCTGCTGCAAGCCAA
GATCATCAGTTTCTCGGCGTCCCCGTGGGCATCTCCGGTGGTAATCATCATCAAGAAGAACGGTTTGGATATACGTCTGTGCATTGATTACCGGCTACTT
AACGGCCTGACCCGATTGATGGTGTATCCAATGCCTCTAATCAATGAGCTATTGGAGGATTTGGATAAAGTACTATGGTACTGTTCTCTTGACATGACCA
GTGGTTTCTGGGTAGTTACCTATGACGGGATCGAGCTCGCGCGATATCCGGCATTCATCACACCGTTTGGACTGTTCGAGTGGAACCGGATGCCGTTTGG
ATTGAAGAACGCACCCCCAGATCTACCAACGCCTGATCGATAACTCCCTGTACGGATTCACCCCGAATACCGGAACCCGAAAGGGGTGGAACCGGGGAAG
ATCATACGGAAGTAGATCCATTCGAAGCAGGAGAGCCAGGGGATCCTGCGACCCCGTCTGTGTTAGGACGCAGATCTTATATCGACGACATTCTAATCCC
GGCGGAATCGTGGGACCTGTTGTGCGAGAGAGTGACATCCCTACTGGAGGCGTGTACTAAGTGGAATCTCTCTATCAGCGTAGTAAAGCGCTATTGGGGG
ATGCGCAAGGTGGATTACTTCGGCCATCGAGTCTCCAAGGAGGGACTGGGGGCGAATCCTAAGGACTTGTCTTCGTTGGCAGGCTTGTACTTCCCACAGT
CGTTACGGGCGATGCAATCGTTCTTGGGCAGTTTGAACTACTACAGTCGGTTCATCGAGGATTACGCACTGTTTGCTGCGGTACTATACGAATTGAGAGA
GGTAGAGTTTGCTGCGATGACCACTTCAGCTGTCCAGATCAAAATCTAACAAGCTCTGGCCCTAGAGATGTCGGATTTACGAAGGGATCCAAGTAGTACG
ACGCCAGAAGAGGACCTAAAACAGGAGCTGGATCCACTCTCGGGACCAAAGGAAAGAGGATCCAATCGGGATAGAGACGACGGATCAGAACTCGGAAAAG
TGGAACCTTCGGTGGATCCGAGCTCAACACGCATTCGTGGAGCTAATGACAGGATCGCGACCACATCTATCCTCCGTCATTTCGATCCGGAACGTCAACC
TACGGTGATAGCTTATGCCAGTGACTGGGCAGTCTCAGCAGCTCTGGTACAAGAACATAAAGGGATCTGTCATCCAGTCACTTCGTCAGCCGGACACTGA
AGCCAAATGAACT