Description :
From Genome Similarity Track
Location :
Scaffold_1071:6084- 7503
Transcript NameFunction/comments
Phyta_totarag11940hypothetical protein

Sequence
1419 bases(100 bases per row)
ACCATTTTGCTCGTGACCGAGAACGGCGCAAGCCGCCCATTGGTTGGCATGTGGAATGATCACAAATGGTTTAGTCCGATCGGGATGCGAAGCATGGGGG
TTGACACTATCTTTCGTTTCAGGATGTCGAAAGCATCTTTTGCCCGAGACAAGTCTCTCCCAGCCCGAACCTGATCGTCTGTCAGCTCGTACaagactgc
agcaaccacaGAAAAATCTTCGATGAACTTGTGGTAATAATTGAGACTACCCAAGAACGATTGGACTCCCTTCAGGGTGGTCGAGAACGGCAGATCTTGA
ATTCCTTTGGCGATCTTCGGGGTAGCTTGGATTCCCTCGGCACCGATCTCATGGGACAGGTACGGGATAGTCCGCTTTCCGAATTCACTCTTGGGCAGGC
TCACCGAGATGTTCCAATAGCACAACCGGTAGAGTAACGCATCCAAGTCGTCGCAAAGTTGATCCCAGGTCGCGCTCCCGTGAGCGATGTTATCGATATA
AGAACTGCGCCCCAGGACTGGACCCATCTGAGTGGGTGCTGTGATATTTCGTTTAAACACCGTCATCTGCTCCGCCAGCGCCGGCAAATGTCGTCCTGTG
AGTCCACCCCGAATCATCTCCGGTAGGGTCCAATTCAGAACTTCTCAGCTCGTATGGGTCTAACTTCAGGTAATCCAAGACATCTTGGTCTACAagggct
tcttcttcgagcgCCAGTCGGACGAATCCCCACAAACAGTTGTTGATCATGTGCTGGTAAATCAGTGGTGCGTTTTTCGGCCCAAATGGCATACACACCC
ACTGGAAATGTCCAAATGGACAAACGAAAGCCGAGATCCACTTGGCTCGCTCGGTCACCCAGATTGCCCAGAATCCGCTGGCCATATCCAGGCTCATAAA
CCACATCGCGCCTTCAAAACCAATCAacaagtcgtcgatcagGGGAAGTGGGTAGTTGAAAAGCTGAATGAAGCCATTTACAACTCGGTAGCCAATGCAC
ATCCTGATATCGACATCATTTTTCTTGAGAACAATCACGATCAGCGAGGCCCATGGTGACTCGGCGTGCTCGATCAATCCGGTTTCcaacagctccttca
gcagctcataCACCTTAATCGCGAGGTGTGGAGCGATCGACCGAGGACGTTGAGCGACTGGTTTAGCGTAACCAACATCTAGGTCACACACCACACCtcg
tgcaggtgctggagcagcatTTCCATCACCCAAGAAGATAGACCGATGGTACTTCAGGATACCCTTGAGCCGGCGATCTTCAGCGGCAGTACTCTCTTCG
GGCTCACCTACGTCAGCCTTGTCGATGTCACATCCCGGCATTAGATCTTGCAATTCGGGCAGAAAATCTAGCTGGTCCTTCAATTAGGCCATCAACTCAC
TTCCTTCGTGGATATACAC