Description :
From Genome Similarity Track
Location :
Scaffold_1612:6082- 7590
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1612-snap-gene-0.5Rraga protein

Sequence
1508 bases(100 bases per row)
CCAGCCTAACTCGTTTGCTGGACGTAGCTCTCGAAAACTGGTCGCGCAGCCTTGATGTTCAGGTGGATCGTCGCCGGCTCTGTTGGAAAACACACACACG
ATCAGAAGTTGATATAGTCTCACACAGCCACGACCTCAGTGATGAGCAGACAGCGCAGGGGGCCACGTACGGATATTCTCGTCCGACATGATCACCATGA
TGTACGTGTTCGTGGTGAAGAAGTCGATGAAGGCCGTGAAGTTCGAGTTGCGCACCTCCATGCCCTGGAACTGCGCCTGGGTCTTGCTGCAGCTCAGCTT
GAACTGCTTGATGATGTTGCTGATCTTCTCGAAGCGGTGGATGTCGCGGTGGTTGGCATGCGTCGCGTGCGAGATCACGAGGAACGTCGCGCGCTCAAAG
AGCACGACCTCATCGGCGTGACAGATCGAGCAGAAGTCGTTCAGGTGCTTCTCGAGGTCCTGCATGTTGGGAATGAGCGAGTACACGATCGACGACCACG
CGCGGTAGAGCGTCTCGTCCCAGATCGACGTGCCAAAGCACACGGTCGGCAGCGAGCCCGTGCGCGCCAGCACCATCTCCTTCTTCTGCTCGAAGACCTG
TATCATGCAATAGAGAGAGAGGAGAAACTCGTGTGTCAGGACACTGCCAGCGTCGCAACAGTAGGTGCGTTTGCCCCGGTGTTCACGTACACGCTCGCGC
TGCTCTTCGGGGACGAGATCCATCTTGTGGATCAGCACGAAGACCTTGGCGTTGCTCGAGTTCTGGTCGATCGCCTCGAGGCAGCCGTCAAAGTGTGCCA
TGTCTTTCTGTGAAAGGGGGAACACACGAACAGCAGCAGGGGTACAATGGTTAGTGATCCACACGTGCAGAATAATGGCACCCATGCGCAGTCCGTCAGT
CGTACGTCGATCTCGCGGCTCTCAATGTCGAAGACGTAGATGAGCAGCTCGACGCTGCGGAAGATGTGGTCGCGCTGGCTTTCAAAGTAGTTCTCGTAGA
ACGCGTCTTGGCTAGAAGTACACACGGACAGCCACACATGATTAGCCACAACACACACGATTACATCGCGCCAGCGAAGAGCTCTTTACCCGCCGCAGTC
CCAGAGGTTGAGCACAAGGTTGCCGAGGAAGCGCACGTGTGAATGCTCCACATCCACTGCATGAACCAATCCAACAGCAGATACACATACGCGATTGAGT
ACGTTACACGTAATAAAAGTTTGCGTTACACAGAACACAAACAGTAAGATGGCGAGACGTACAGGTTGGTCCGAGGCGCATGGTGTCACGAGCTACACAG
GTCAACACAACGACGTGAGGCATAACGACGTCAGTATCATCATACAATAGCAAACGTATCAAGCGGCAGCATGTAGGGAGGACGACTGATGTGCCAGCAG
CTCTTGCTTTGCGCGTACCGAGGTAGTTGGCGAAGATGATGGATCGCATGGACGTTTTGCCCGAGCCGGACTTGCCCATCAAGAGAACCTGAGAGAAAGC
ACGCAGGC