Description :
From Genome Similarity Track
Location :
scaffold_64:60816- 63058
Sequence
2242 bases(100 bases per row)
GAAGGGAAGGTTTGATGAGCAGACTTGGGAAGCTCTAAGGACCAACCTTGTTTATGGACGTTGCTGATATATTTCCAGACAAGGTGCAGGCAGATTTGCC
GTCTGACAGAGGCATctgtcatgagatcaacaTACTTCCTGATATGGAGCATTGTATCATACGGCAGTTGCCGTTGTCAGTAGAAGAAGTGATTGCGACC
GGCAAGTTCTTAATGCAGCGGCAGAAAGCTTCTTATGTGcatgagagtaagtctcgtCATTATAGTCCAACCTTCTGGGTGAAGAAAGCCACGAGATGCT
GGCGCATTGTCCACACTTTCAATAAATTGAACGATGCGACCATACCTGTCCTGTCTCCGGTTCCACGCAAGGATATAACTCTTGATGGAATAATTGGCAG
TTCTATTTTCAGTGCGATCGATCGAAAGATAGTTTCTATCAGATACGAGTGCGCAAAATTGATTGCAGTCAGTATCCCAGTCATATGCTGTGGGAATTCT
CACAGCATATGAACGGTTAATGATGCCATAAGGTTTAAAAAACACTCCCGCGACTTTTATCAGAATGGTCACGGATCTGCTTCGTCCATTGAGAGAGTTT
GCACCGAgttactttgacgatatattcgtGCATAGTAAGAAAACGGGTGAAAAgtcgatgttcatcttgGTCATCTTCTTCAGGTCTTTCAAGTTATGCG
AGAGAATAAACTCTAAGCTCATATGAATAAGCGCATTTTCTTTGCACCAGAGATCCCCGTCCTCGGGATCTCTGTAGGCAAAAATGGCCTTCTTGTAGTC
ACAGCTGTCAATGAGTGGCCCGTGCCAACCAATGTGATACAATGGCTGGGCTTGTCTAACTATTTGAGCAAATGCACGCACGATTATGCAGCGTCATTGA
GCCCTTAACGACTCTTAAGAAATACGTTAAGTGGGAATGGTTGAAATTTCACCAGGCGGTGAAAAAAAAGCTTGATAGAAGCTCCCGTCTTTGCGATTAA
AAACCACAATAAGCCTTATCATGTGGTCTGCGATGCAAGTGATTTATGCCATCGGTTGTATGTagatgcaacacgatgatgaggGCCAAGAGCAAGGTTT
TCATAGCAGTCGCTTTAACTCCGGCCCACGGAGCGAAAATACCCAGATTATGGCAATAAGCTCCTAgaaatgaagtatgctttggTTAGGTTCCGTGTGT
ACTTTTCTGCAGAGGAGCGTCTTGcaatctatacagatcatgccccATTGCGTACAACAGTAAAGACTCCGCGTTATCGCAGATAATAACTTGTTTGTTT
CATTCTTTGCGAAGTACAGCGATTTGTGCTCTACAAACTTGACAAGATGATCATCTTAGCTAGTGGGTTGTCAAGTCATTCAGACTATAATCCAAATCCA
GGAGCGAAAACATGCAAATTTCATTTCGACAATGTGAAGATGTTCAGATGATCAGATTGCAAACAGCGACTACAGTGCGCAAGAGGTCGTCGAAGGGTAC
AAGTCCGATGGGATATTCCATAACCCGTTGAGGTTTACAATGACCTTTCCAacaaagcactgcaaggACTTCCGTCTCGCACAAGATCGCGAGCTCGCCG
TTTGGAGTACACAACGAGCTGTTGTACTTTGCGGTTGAACACGAAGATACTTCAAGAGGTGTTGCTTCAAATGACGAAGGTTTGCGTCATCGTCTCATAT
ATGAGTACCATGACAGCCCTTCGGTAGGCCATCTCGAACGTGAGAGaacattttttaaatttttttcgCCACACCTGTATATAAGTGGGTGCGCAAGTGT
GTGCGACTTGTAAAACCTGCCAGAGTGAAACCATCGGGATCAATCAGGCCCCACTTCGGTCGTTGGTAGTGCCAATTGACAGCTGAGATGTCTGTGAGTA
TGGGCTTTATATCTGGACTTCCGCGTGGCAGACATGATGGCGTCCTTGTATTGTTTGATTGATTCAGCAAAACTCTTCATCATGCGCCTGTTTCGGATAA
GATCTCGTCCGCAAAAACAGCTAAGGTGTTTGTAGACGTTGTTATCCGTCTGCATGGTCTTGCTGTCGAGATCATGTCTGACCGTGACAGCTGTTTTGCG
CCAAAGATTTGGCGCTCACAGTTTAAACTGTTGGGCACCAAATtgtccatgtcaacagcTACAGACCCTGAAAGGGACGGTTAAATAGAGCGTGTGGTTC
GAGTCCTGGAAGACGTACTGCGTAGTTACGCTACTTTTTCCA