Description :
From Genome Similarity Track
Location :
Scaffold_148:60803- 65205
Sequence
4402 bases(100 bases per row)
GCTCTCGTCAAATGGAAAAGGGAAAGGCCGGAGTATGAGGACGTAGTCGAAGCTCGGTGCGCTACCACTGGCGAAGACAAGTCAAAAGCTCTACGGAGCG
TAAAGAACTCGTTCAATCGGCAACTCCTGAAGACTCTCTGCAAGTTTGAGTGGGGAACCACCGTAGAGAAGATCACGGAGGACAGGATTGTGTCAGAGTT
GGACAAGATCATCGGTAATGTCATGAATGATGTCATTCTTGATATTGACTCGATTTTTGATGCAAGGTTGAAGATGGACCTTGATCAACGAGACGTCAAA
GCTCGCGTCCTGAACTATTTCATGCTGTGTGATGAGATCATTTTGGAGAACGGACTGGCGAGTGCCTTTGCTACAGCAACAGGTATTAAGGAAAAATGCC
GAGTACTGAAGAAGCACTTAGCACCTGCGGCCCTACGTGATGCAGTGGATAGTCACCTACGACTTGTGGACACTACAAGAAAATCCGACGAGAACGCTCT
GTACGTCCTCGTGAAAGAGAAAGCGCTGGAGCAGACCAAGGTGGACCGATTACTGTCGACACGCAGGCACCAATCAAACTGGAAAAACAGTGGAGGAAAA
ATGACGGCCAACCCCGCACAGTCCTTGCAATGAAGTCGTCATTAACTCCTGCGGTGAAAAGCAAACCACGCACGGGATATTTTCACTGCGGTAAAGATCA
TTAGCTCAGTGAATGCCCCGATCTCAACGAAGCGGGAAAAGAAGAAATTCTCGCTGATAAGAAGTGCAAGAGGAAGACCTTTAGTGGAAATGAGAATAAC
CGGTCTCGTACGAAGCGTGTGGAGATAACCTCGACGACGAGCACGCAGGAGCGACCCACTGTCGTATTAAATGGACTCCTTGAGCTACCTTACTGCGCAG
ATAGTGGGTCGGACTACAATATCATGTCACGAGAACATGCTGATCGACTTTGCGAGCTTGATGAGAATATTCTCCCTGTGGAATTGAGTGAGCCGATTGA
ATCGCGTGCAGTTGGAGGTACGATTTTGACATCGACCCACGCTATCGATGTGATCATCACATTAAATACGGCCGCGGGACCAGTACGATGCCAAGACCAG
AAGCGATGCCTGATCGTGGAGTCCGACGAGGACGAGTTTCTGGTTGGTAAAACATTGTTAGCTGAGCTTGGCATAAATGTGGATCGTCAATTGGAATACC
TTGCAACACGTGGAGACGATGATGAGACCTTTGATGACCCGGAAGGTATGCCGACCTGTAAGCCAACAGAGGAAGATGTGGTAATGAAGGTAGTGGATAC
TCTGGTACATGACGCAACTAACCGTGGCGTTGTGGATGAATACATCACGACCAGACTGTACACTATTTTACGTCGTTTTGGAGGCTGGAGACTGGAGGTT
GGTAACGATCCACCAGCTCGAGCTCCTCCTCTAAAAATCCGGCTAAACCTGGTGCAGCTCCCTACCGGTGCAAAGCACGCCAATACAGCCCGGAAAAATC
AGAATTTCTCGATGCTTTTAACAAAAAGCTTGTCGAATTGGGGTGGGTTTATGAAAACCGTGAGAGTCGCTTGTGTAGCCCAGTCTTACCGGTTAAAAAG
CCCAGCACTGATGACTACCGACAAACAGTGGATTATAGGCCGACAAATGCTCTTACCGAGCCTATCGCTGGTGTGATGCCGAGTCTTGAGGTGGCGTTGG
AACACTGTCGAGGAATGATGTACTACGCGATGTTTGACTTCCTCAAGGGCTTTTGGCAGCTCCCATTACACGAGAGCTGCCGTGAATTTCTCTCGTACAT
GACCGACCGCGGCGTGTTCACGCCAACTCGGGTTCCACAAGGAAGCACCGACGCTGCCCTACACTTCCAATCGACGGTGGAAATGGTTTTAGGTGATTTG
GTGAACACGAATGTCATCGTGTGGATCGATGACCTCCTCGTTTTTGCCTAAAACGCTGATAAATTGGTTGAAATTATTGATGCCGTACTTCAGAGGCTGG
ACGAGTCTGGATTTATCCTAAATCCAAAGAAGTGATCTTTGTTTCAAACTGAGGTCCGCTGGTGTGGCCGCATCGTCAACAAGGATGGAATCGGTCATGA
CCCGAGTCGCATCCAGGCCTTAAGAGATATGCCACCGCCAGCGACTGCCGCTGAACTGCAGCAATTTCTCTGCGCCACCAATTGGATGCGCGCAGGTCTA
GTTGACTACGCTCGTGTCGCAAGGCCATTACAGGAACGTCTCGATGCAGCCTTGGTCGGCACTAGAAAAACCAAGAGAGCTGCAGCAGGGGTGCAAATCG
ACTTGACAGTGGGGGAATTGAAAAGTTTCGATGCAGTAAGGGACTTGTTGGCACATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTCTGATGCCTCTGATTCTGGCTGAGGATTAGTTGTATTGCA
AGTGAGTCGATGGAAGCCGCAGAATCCGATCCACCAACAGGACCATGAGTTGCTGGTCTGTATGGGAGGCAGTTTTACTGGCTCAGCTCTTAACTGGAGT
GTTATCGAGAAGGAATCATTCCCGATCGTTCACGCGTATGAACGACTGGAATATCTATTGCTTCGACCACAAGGGCTCAAACTATACTGCGATCATCGGA
ACATCGTCTACCTTTTCGCTCCCGGCAAAGAGTTAAAGAAGCATGTGCGCGGGAAGCTCTAACGCTGGTCCACTAAACTATTCGAGTACCGATACTCTAT
AGAGCACATTGAGGGGACTCACAACGTATGGACGGACCTGATATCGAGGTGGGGCGGCAAACCCCTACCAAGAGCGCGTATTCACTCGGCCAAGAGGTTT
ACACGAGCCAATCGCAAGCGTGGAAGTGGTTCAAAGGCGAGTCCAGCGCCTCCATCGCTACACCCCCTAGACCAGGACGGTTTCGTGTGGCCTACAGTCG
AGGAGATTGGTAGCGTGCAATCACTGCACGACGCACCGAAGGGTGCTACACTGAGTGGTGATAAACTATAGCTTATGAATGACGTGATTTGGATACCAAG
TGGAGCTCACGACTTGACTCAAAGACTTCTCGTCGTCGCGCACTGTGGTAGAAACGGACACCGCGGCATGCATGTGATGGACCACATACGCCGGCTGTTT
TACATCTCTGGCCTCACAAGGATTGTACGTGACTTCTGCTCGAAATGCCTACTCTGTCTACATGTGAAGGGAGGGGTAGTGATCCCTCGACCTTTTAGTG
AAACTCACTACACCTACGAACGGAACGAGACGCTACACTGGGATTTTTTTTACTCTGGGTGATCCTTTCGGCACATCCCGCTTCACGCTCGTGTTGAAAG
ATGAGGCAACGCACTTTACGGAACTGGTGGCTTGTGATAGCCCTACTTCTGAAGCTGCAGCGAGTACCATCCTGGATTGGTACTGTCGCTTTGGAGCACC
TAGGGTGTGGGTAAGCGACTCTGGATCGCACTTTAAAAGCAGGGTGGTATCAGAACTTGGCCGAAGGCTGAAAAGTCGTCAAGGGTTCGTGCTAGCATAC
TCACCTTGGAAGAACGGCTCAGTAGAGCGGGTGAACCGGGACATCCTGCAAGTACTGAGGGCACTGGCACTGGAGTACAAAGTCAGCTTGCCCGATTGGC
CTCACTTACTTCCGCTGGTGCAGTCCAGCCTAAATCACTCCCCGGTACCGTCGCTGGCTAACCGGGCTCCAGTTGAGCTATTTACAGGACTACCATGCCC
CAGTGCACTAGACACGGTGTTTTTTTCGGGAGGGAAGGGTGTAACTACGCTGGACAAGCCAAAGCCAAGTAAAATAGAGCGACTCAACAAACTTCGAAAA
AACATTCGCAACATGCACAAGCCCGTCAAGGATGAGCGACAACGCCAGAACAAACGGTACCGGCTACGTCCACACCACGAGCAACCTATAAACTTCTCTG
TCGGTGATTACGTCCTACGTTCTCGTGTCGATGAGAAGCTACATGCAAACAAGCTACGTGTGATGTGGGTCGGTCCGTACCGTGTGGTTGGCAGTGCTAA
CTACTATTTCACTGTGGAACATTTGGTCAATGGAAAAAGAATGGACACTGTATGCTGACGACTCGCTCAATATGACTGAGGAGCTTCTCGATCATATTGC
CTCTCAAGGGACACTGCTGGCTGTAGAGGCGATCGATGATCATCGACTGAGCGCAGACATGCCGGCCTATGAGGTGAAGGTAAAGTGGCTTGGCCTCGAG
CCTATCGAGGACTCCTGGGAGCCTTTGAAGACCATGAATTAAGATGTGCCACAGCTTGTGCTACAGTACGCCACTGATACTGGCGATGACACCTTCCTAC
GC