Description :
From Genome Similarity Track
Location :
Scaffold_1740:608- 2493
Transcript NameFunction/comments
Phymu_g13601hypothetical protein PHYSODRAFT_325775

Sequence
1885 bases(100 bases per row)
TCGAGTGGCGACTCGTCAgatctcttcctcgcgtGGTAGTACTGCCTCGCAAGGGAAACGCCCAGCCCACAGTATTCGACTCTGAAGCCATCCAAGAGAT
CTTTCCATTTGCCACGGGTTGATCTTCCCAGTTGCTGGTACCAGTTCCGCGCAGGGCCAGTCAGCAGGTTCCCAAATACGATGCATTTCTCGCTGTCGGG
GGCCTGGTCGCGGACGAACGCGGGCTTCACTTTGCCCAGCCAGCTTCGAGCACGATCTTCGTCGGTGTCTCTGCCGGAGAACACCTTCAGCTCAGAAATG
GCTGACATCCTGACACGGGGAATTGCTGACGCGCTCTCCGACGATGATGTGGCTGTCTCCGCCGAAGCTACTACAGCTCGGCGTGGGGCGTCTATGATCA
AATCGTCGGGGTCGTATTCATCTGGGGACCCATGCAGCGACTCCACTGAttccatgtcgacgtcctGCATTCCTGGCGTCGGTGGCTTGGACTGGCTGGT
GGTCGTCCCCACGGCTTGCTCTTTCAAGAAGCGTTCCATGGCCGTGTTGAAGAACACTTGCATGCGATCGGGGCTGTGGAGATCGGGCGTCGTCCTAGGC
GTCGCTCTAGTGCTGACTGGcactttctcctccttgatcttcctcgATTGGAGCATGGCAGCGCCGGACGGACCAAGTGTCATTCTTGCTGGTTGGATCA
TGCCGTCCGACTCGGCATCCGAGGAAACAGACGCCTTCGCAGACGCGAATCCTGAGTGCGAGGATGCAGAGGTGGGGTACTCCTCTGTCGGGCCAAGACT
CGATAATGTCGAAATCGCGCCCGCCAACGGCCTAAGCAACTTGAACAGGCGTCTGGACGACTCGTCGACGGTGGCCAGGCTGAGCTCAAACAACGTTTCT
GCATCGAAtgctccagcgacgatcCCAGCCTCTTCCAACATGTTCATCAGGCTCGTGATCGCGACCATGAGATCGGATGCTTTGACCGGGGAGGTCACAG
GGCCTTGGAGTTCTCCGATcatcttcggcttcatcACTATCATCACGGGACCTTCCAGAAGAAAggcgttgagctgcttccgaCAGAAGATCTTCTGTAA
CTGATCCGGAGTCCAGGTCCTGACTTCTCCACTCTCCTCCGCATCCGGAGCCCTCATCTTCGGCGccaacttcgtcttcacggaGGTGCGGGGTGTGGGG
GGAGTGGTTGTGGGTGAAGTTCCTTCCATTTTCACGGATGGATCTTCATCCGGCGGATCGCGATTCGCATCGCGATCGCAGTCGCCATCTCAGCCACACA
AGACTGCGCGCGAAGGTCCCAGCCGATCTCACAGTACCGCCGGCACAGCAAACGGGTGGAGCTGAGAGTCAAGAGATCGCGGATGTTCCGGGTGAGACCG
ACCCGGATCCGGTAATCCTCCTGTGGATCCATCACCGGATCAGCCCGACACCGAGGAAGACATTTCCGACGAAGAGTTTCGGATGATGATACCGCATTCC
ATGTCTGCGTTTCGCCGCTATGAGCTCCGGATCAAGCCCGTCTCGGTAGTCAGAGTGGACCGCCGCCGCAAACGCCTCCGACGCACACTACGCCCCCTCA
CCCAGACAATCCATCCACCCCACTGCCATCCCACCATGGATCACCCAATGGCGGATCGCCCGGTGGAAATAGGGGATCTCCCGGAGGTGGCTCCCCTAGG
GGAAACtcgccccccccccccccctgtCTTACGGCCGTCACTGTTCCCTATCACGTCGTCCATCCCGGCATACGGGCAAACACGACAGTTCCAAGCGGCG
GACGTGTatgtggtggagcagaatcttgtttgTGAGAAAGCCGGATCGGCATGAGGACCAAGGTacccactttgtggtacGCCAC