Description :
From Genome Similarity Track
Location :
scaffold_151:608- 1993
Sequence
1385 bases(100 bases per row)
CCTCATTTATCTACAAATGAGTGGATGGCTCGACCGCATGCGAGAAGTCATTGGAGAAGCTGCAGTAGTCAGCTTACTGCAGTCGTCTTCTCCGAATAAT
CAGAAAAACGCAGCCGTCAGTTTTATGCATAATGAGACTATGGAATCTCGGATTCAGGTCGCGAGCGCTGTTTCTTCGTACAGAACAATGTATCTGAAAC
TGAACGTGACTTTGTACCGTTGTGGAGAGGACGAGCCTCTTTCACGATGGTCTGTCGAGTTGGGtgcagcaatcactgcaagaCAACTGCGAGATCCCTT
GCAGCAAATGGGTTCGCAATGTCCGACCTTGCGGGTTTTGTGAAGAGTTGGACTTATGGGAAGTGTTTAGCCGATCTAAACTGCTTTCCTAGCTACGAAC
ACTTAAAAGTCGAGCTTAAGAAGGCGTTTGAACCACCGCAGAGTGAGTTTTGTGCCGAGGTTTTGACGCGTCATCAAGGGCGTTTCGACCTAAACTGTTA
TGCACAACGTGCTTGCTACTTGGTATCGAGCGTCGTCGACGAACCAATTGACGTTTCAACGCAAGTCGTAACGTTCATGGCGGGCTTTAATGACGGTCCa
atccggagtcaattgttccGCGAGATTCCGGAGACGCTGAATGATGCCATCAACCGTACGATGCAAGAGGAGTTCAGCAACAAGCAAGCCAAGTACAATG
GCTTCACGGCAAGCGCGCCAGTCGATGCGTACAAAAGATGGTTTAGAGCCGATGAACATCTCGTACATTTTGCCGCCTGGAAATGAGCGTTCTCGCAACG
ATGGAAAGTGTTTCCGTTGTGGGAAGCTGGGTCATATTGCCCGGAACTGTAGAGTGTCTTTGCCGAGTCGGCAAGTGCTCGTTCGGATAACCGCCGCAAA
CGCTATAAAATTCGTCGGCTCAAACGCTCCAAAGAGTAGAAAAATGGGAACAACCAGTAGGGACTGGGCTTCCTACTAGGTCCAAGAAACACGATACAGA
ACTCTGGCCCAACATGCATGCCGCACATGCATTTTCCACTATGAGTGAGAGAAGCGTCAGGCAAAGCGCGACTTGATTGTCCAAGAAGTATTTCTAGAAG
ATCTTGAGAAACCACTACGAGCTTTGATTGCCACTGTTACTTTGTTCGAGCGCGAGTTATAGCGGGACATGGTGATAATTAGTTCGATGTGAAAGAAGAG
ATGATCATTCGGTTAGCGAATGGATCTAGAATGAAGATACCAAAGCAGGTCATTCGCTTGGCAGTATAGTTTGAAAATtttcgaggtgaagacgagttta
tcttacTTGAGCTCGATGATAAGTTTGATATCATCCTAGGCATGCCATGGTTGAAGTGTTACCAGCCTAGCATTGACTGGATGAA