Description :
From Genome Similarity Track
Location :
Scaffold_1284:608- 1984
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_1284-fgenesh-gene-0.1Dicarboxylate/amino acid:cation

Sequence
1376 bases(100 bases per row)
GTCTCCCCGACAAGCTGCGCCACGATGCGCACCACGATTGTGTCGCACGTGACGTTTACCGCGGTCTGGAAGCGGTCGATGAACCAGTCGGTCGCGAGCA
CGAACGCGTAGGTGGACGGCAGGTCCACGTTCGGGAACACGCTCGTCCAGATCGTGATGGTCACCACGCTGCCGTAGGACGGCACGGGGCCGGCGCCGAT
CGCGCCGATGGTTGACACCAGCACGATCAGGAAGTACTCGACACCTCCGATCAGATGGCCCAGCCCCTCGGCCTCGGCCATGAACACGATCGCGACCGGG
TACCCGAGCGCGCCGCCGTCCATGCCGATGGTCGCGCCGAGCGAGAGCACGAAGCGGGACAGCGTCTGCGTGACCTCCTTGGTGGCTTCGACGCACTCCA
TGACCACCGGCAGCGTCGCCATCGACGAAGAGCTTCCGAACGCGAACACCTGCGCTCGCGCCATCTTGAAGATCCACTTGAACGGATTCGCCTTGACGAA
GATGCGCAGCAGGATTGGGTAGAAGATGTACACGTGCACGAAGAACACGAGCAGGTCACACAGCACGTACAGCCCAACGCCATTCACCAGCACGGACATG
TCGTCCTGTGTGGCGATCGACGAGGCCAGCAGCGAGATGATCGCGAGCGGCGTGCACTTGATGATCCACCCGATCATGGTCATGAACACAATGTTGATCT
CGTGGAAGAAGCTGCTGACGACCGTGGCGTTGCGTGGCAGAAGCGAGAGCGCAACGCCAAACACGATCGCAAACATAATGATCGAGAGCAGCGTCGAGTC
CGCAAACGCCTGTGTGATGTTGTTCGGCACGATAGCATCCAGCTGGTCCTGCAGTGCGTCCGAGAGCGAGCGCTTGGCGGATCCGGCGTTGTTGGTCGCA
AAGTAGCCGTTGATGTCCGTGGTCACGAACTTGGACGCTGGCGAGAACGCGGCAGTCGCGTTGTAGGTCGCATCGAACGCACAGGTGATGGTCCCATTCG
CGTTGTGGCTTAGAAAGTACCCTGGCTGGTCACACTGGAATGCGAACTCGGCGATCGTCTCCTCGACGACCTGGGACTTGTTGCCAAAGTACGGACGGAA
GATCAACACCCAGATGAGCCCCTCGGTCGCAGCGACGACAGTCGTGAGTAGATAGAGCAAGCCCGTGCGCACGCCGATGCTCGAAGCCTTGCCAACCGCA
AGCATGTCCGCCATGCCGACGATCAAACTGCAGAACACCAGCGGCGTCACGAGACACTTGATCGCGCGGATGAAGAGCTTGCCCGGGACACCGATCCAGG
ACACGAGCTCATCCGACGGGCTCCCCGTCTGGACGACCCAGCCAACGAGAACACCGATGACCGCGCCGGCGAGGAT