Description :
From Genome Similarity Track
Location :
Scaffold_820:608- 1897
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_820-fgenesh-gene-0.1Dicarboxylate/Amino Acid:Cation

Sequence
1289 bases(100 bases per row)
GCGCTCGTTCTGGTCGATCGTCTCACCCACCTGCTCCGCCACGATGCGCGTGACGATGGTGTCGCACGTGACGTTGACTGCCGTCTGGAAGCGGTCAAGG
AACCAGTCGGTGGCCACGATGAAGGCGAAGGTGGACGGcaGAGCGATGTTGGGGAAGACGCTCTGCCAAATGGTCATGGTCATGACGATGCCGGCCGCTG
GCACAGGACCCGAGCCCACAGCGCCGATCGTGGAGACAAGGATGATAAGGAAGTACTCGACTCCGCCAATGACGTAGCCAATCCCGGCGGCCTCAGCCAT
GAAGACAATGGCAATAGGGTAGCCGATAGCAGCACCATCCATGCCGATGGTCGcGCCAAGGGAGAGCaCAAAGCGCGACAGCgTGGGCGTGATcACCCCC
GTGGCGTCCATGCATTCCATGACAACAGGCAGCGTGGCCATGGAGGACGCACAccccATGGCGAAGATCTGAGCACGAGCCATCTTGGCGATCCACGCGT
ACGGGTTGCACTTGACAAAGGCACGCAGCAGCAGAGGGTAgAAGATGTACACGTGGACAGCGAGCGCGATGAGATCGCAGAGCACGAaGACACCGACATC
CGAGACAAGCACGCCcAAGTCTGTCTGCACAGCGATGGAGgACGCCAAAaGaGAGATGATGGCCAcGGGCGTGCATTtGATGATCCACTTGATCATGGtC
ATGAACACCATGTTGATCTCACGGAAGAAGTTGGCGATGAGTGTCATATCGCGAGGCAGCATGGAGATGGCGATGCCGAATGGGATCGAGAACATGATGA
TCGACAGGAGCAcGCCTTCAGAGAAtGCGACGGTGATGTTGCTGGGTACCATCGCCTGGAGTTGGCCTTGTAGCGCTTCTGTGAGCGACCGCTTCACGAA
CTCGGAACCGCTCGTCGCGAACTTGTTgTTGACGTCCGTGACCGTGAACTTGACTGCACTGGAGAaCGTACCGTTCTGAGCATCCGCGTTGAACGCgCAG
GAGAGGGAGTTGTTGGCCTCGGTCACGAAGTAGCCAGGCTCATTGCACTGCAGTGCGAACTCAGCAACCGACGCTGCTTCGTCCTTGCGTTCATTCCCAA
ACCACGGACGGAAGATGAGCACAGCGATGAGCCCTTCTGTGCAGGCCACGACGGtcGTGGTGAGGTAGAGCAGGCCCGTCCGCCAGCCGATCTTGCCGGC
CTTGCCCACGGCGAGCATGTCGGCCATACCGACGATGAGGCTGCAGAAGACGAGAGGCGTGACGAGACACTTGATGGCGCGGATGAAGA