Description :
From Genome Similarity Track
Location :
Scaffold_108:60798- 62744
Transcript NameFunction/comments
g7893.t1ETP41862.1 hypothetical protein, variant 3 [Phytophthora parasitica P10297

Sequence
1946 bases(100 bases per row)
TGACCCCGTTGCTGCGCGTGCTGGGCAGTTTGGAAGACGTGTCTCGTGTGTTTGATAACTCGCTTGTTACACCTGAGTGCGGATTAGTTGCTGGGCTGTG
ATTGCTGTCTAAAGCCACCCAAGACCACGAGCTGGCGTTGCAATTCGAGTTCTTGGATTTCTTCTTTCAGCTGCTCAATGTTGTCTTCGAGGGTCTGCAT
TTGGATACGTTGCTTCTTCTTGTAGCGTCGTTGGTGCAACTTGTTCCTTTCTCTGCGGAGCGCCAATTCGTCCTCCGCTCCTTCGTTCTTGGTTTGTTTG
GCAGGAATCCTCATTTTCGTGTCAAATGTATCCAGTGACGACCAGCGCTTGCGATGTCGACTCGGTAAGCTCGTTTAAACGCCTGCAGCGATTGGGGGAT
AGCTCGGACAATAATATCATGAACAACACGGTCGCTGATTTGGCGATAGTGTGGACGAAACAGAGCGCTATCGATCATGGTCTTACGTGGCTTCTCTTCT
GACTGATCAATTTCAAGCGAGGAAGCGCTCACTCCAGAGTAGACCGTATTGTCATGGCGTACTGGGTGTCAAATCCACGATACAATCACAAAAAGTCGAC
AGCTCACGTGTCGCTAGGTTATTAGCAGGGATCACCTAACGTCGTGTCATACTCGTGAGTCACACGACGAGTGAGCCTTCCACTGTAGTTCTCACGAAGC
GGAATAGTCAGAAACACTCAAATGACAGTACTCCAGATATTATTGTGTGCTTGGACACTAGACAGCAAACTGCTGCTTCAGCTTGAGCTCCTGATCTCTT
CTTTCAGTTGCTATGCTTTACCTTGTACCACGCTTAATGAATTCGATTGCGCTGACTTCGGAGCCCCATTCCGTCTGAACGCGTCTTGTTGGTTTCCTCA
ATGGAGCCGTCTACTCTGCGCCTCGACCTCTCAGAATTTGCATTGGCCTCAATCTGTTGGTTTAAGTGACCGCACGGAGGATGCAATGCTTACTCTCACC
TGGCCATCTTCAGAAACGATCAGCTCGCGGCCGGCTCGCGCTCTCTGATAGACGTTGCTTACAACGCTGTCGCTAAGCCAGAAGCTGTTGGGAGGGGAGA
GCACGCTGTCGTCCATAATCAAGCTCGTAATGAAGTCACGTGAGTTATCGGTTAGCTTTTTGCCTTTTGGGCAGTTGCCGTCGAGGAATATTTTACAGAG
CATCGGGTAGCGCTGTATCAACATACGACACTTCGACCGCTTCACGTGACACCACCAGTCTACCTTCCGGGGTGAGTCGAGCCTGATCAAAAACACAAGA
AACCGCGTCCACGCTCCCAAGCAAATGGAGCAACGGCGTCAAAATGTCCGCCTTGCACTCCACTCTCGTAATTCGACCACTGGTGCTATCCCACTCAAAC
TGCACCAAGCCGCGCAAAGTTAGACGCTGCCCCAGCATCTCGGTGGCGAGGGCAGACCATCTTCCGTCCCGGACCAGGTGCGGGAACGCGAAGCGCAGCG
TGTTTTCGTTGACCGTAAGCGTGCCTTTGGTGGTAGCAAATACCACGTTATCAGGGCCTTTTTCCATGCGCACAGGCTGCAGATCAATCTCCTCATAACA
GAGCGACTGGCTTGCCCAGGTCTGCAAAAGGGCCTCCACGCCCCACACAGCACCATCCGTCACATCCGGCGCCATCGTAGCGCGCAGAAAATTCCGCTGT
ACGTGGTATCCATTACCAAGAGCCGTGGGAGCTTGCACTTTGCGCCGAAAGAGGCGGAAAAACTCGGCCGCGACGCTCCACATATTGGTGCTCGTTAACG
CTCCGTAGACGATGAGCTGGCGCTGCAATTTGAGCTCCTGGATCTCGTCTTTCAAGTGCCGGATGGTCTCTTCGAGGTCCATCACGAGCTTGTTCTGCCT
CATCTTGTAGCGCGCCTGGTGCAGTCGATTGCGCTCCCGACGGCGC