Description :
From Genome Similarity Track
Location :
contig_24:607920- 635064
Transcript NameFunction/comments
g5768.t1POM64224.1 Neutral zinc metallopeptidase [Phytophthora palmivora var. palmivora
g5769.t1RAW32588.1 hypothetical protein PC110_g11099 [Phytophthora cactorum
g5770.t1hypothetical protein
g5771.t1hypothetical protein
g5772.t1XP_009529772.1 hypothetical protein PHYSODRAFT_560562 [Phytophthora sojae
g5773.t1XP_009529774.1 hypothetical protein PHYSODRAFT_560567 [Phytophthora sojae
g5774.t1ETL94500.1 hypothetical protein L917_07560 [Phytophthora parasitica
g5775.t1POM58505.1 Iron(III)-zinc(II) purple acid phosphatase [Phytophthora palmivora var. palmivora

Sequence
27144 bases(100 bases per row)
TTCCAGGGCTGCGCGCACCGCCTCCTCGTTCTTGCGCTGGGCCAGCAGCCCTTGTACCTGTGTGGCGCGGGCCTGGACGCCCGCCGCGATCTGAGTCTCG
TTCACCGCCATCTTGCTCCTGCTCTTTTTGTATGTGTCGCAAAGGACCGTGTGCAATTGTCACCAAACTTGCCAAATCCGGTGATCGGCTTTGACGGGGA
AGTGAAGCGGCTTCAACTTGACCTTATTATCAGATTTCGCGTGCATTGCAATTCGGCCACAAGGAATTGGGAGTGATATTACAGTAAATAAAGGAGGAGG
AGCTCTGGAAGTGGAAAGGTAAAAAGCTCGGTTGGAATCTGCCATCAACTTGCTGGCCAACGCATTGCAGCGAGTTTACATGATGCTGCAAAAGATCGGA
ATCGGCAAGACGCTGTATGAGCGGCCACTGCTGAACACGCCAGCAAAGCAGAAGGAGAGCCCAACAACAAAAATCGTCAGCACCTACCCACTGTAAGTAA
GCAATCAATACCCGACACGTACACGATCACTGGTCGGCGGTGTTCCATCAGAATCTGGTTCTGTGCGCCGCACACTGTGCACTGGAATGTCGAGCCGTGG
GTCACGTTGCGCACTACATGCGTCGTACCACAGTTGCCGCACTTGTATGGCATCTCAGCCTGCGGGACTGCCTGCGCGACCGCCACCATCGGATCCTGGT
CGTACTGAGTCTGCAGCTGACGCGCCACCTCCTCGTCGCGGGAAGTGTCATTCTACAGCAGATAGCAACGTCCATAGCGTCAGCTCCGAGCCCGTCGGAC
TCAACCATCATTGTCAGTTACCTGAATATTCATCGAGACCTGTTGGGCACGCGGGATCTGTGGGTACAGAGGCTTGTCGCCGCCTGGAGTCGCCATGGTT
TGAGTCTTCTTTCTTGGTCTCAATTCAAGTCGCTTTGGACTCAGAATTTCTTCCTTGCGACTAATAGCCAATCAGATCTTGAGATGCTACTGACGGCACT
ATCCCAATCAATTTGTAGCAGAGACGATGGGGTTGCTAGAGCTGCTGGGGCAGGTGGAGCGTCTGGGGGTTGGTATTGCCCTCGTAGTGGCAGTACTGGG
AGGGCTTTATCTGTGGCAGCAAGCGGTGGGGGTGTCGGGATCACCAAGATGCTGCGGGACTTCAACCTCGTGCGCGTGCTCAAGCGCACGGACACGGAGC
TGGCTACTGGGCAATTTCAAGAGCGACAACCACAAGAAGGCGGCGGTGCTGATCATCCAGACGGCGGCGATGGATACGGGAACTTTGGGTCAGTTGTTGA
CGGGGCTGTCACTGCATGAGATTCTGGTGAACGACATCTACAGCACGTTCCAGGGAGACGTCTCGCGCGATGTCAAGCCGTACAAGGTGGTGATGCTGAG
AGGGATGAGAGGGGGGGGGGGTGACGGTGTAATTTACATTGTTTGTGCTTTTGTTTGTTTGTATTTGGCTAGGTAAATTTGATCTACCCGGCGACGGATC
GACATGTGCGCAAGCACACAGACCAACATTTCCACATGGTGGTGGAAACCAAGGACGCGTATCGGATGATCACCAAACCGTTCATTGACAGTATCCCTGC
GGAAAATATTGAGTGGGTCTACAATATCCTGGACCAGTAAGTGTGCTGGAACTGCTGCTCTGGTGCGTGCTACGTTGTGTAGCGTATTGACCGGTGTGTG
TGTTTGATGGAACAGCAAGAGCGAGACGGAGCGGATTATTTACGAAGACCCACACCATCGCAATGGGTTCGTTTTGCTTCCCGACTTCAAGTGGTCGGAC
CCTTCCAAGGTGAGTCCTGCGTTCTGTAGTCTGGTGCTGTCAACACAATAACCCCGTTATGCATGCTGACCGCTGGCTCCTACGTTGACTTTAGTTGGAG
TCACTGTACTGTTTAGCCATTGTGCATGACCGCTCGCTTCGATCACTTCGCGATCTCACTAGTTCACACTTGAAGTTGCTCCGAAACATCCGGTAGGCTC
AGTTTGTTATCAAGTTTTTTTTTGGATCCGGCAAAAGCTCACGTTTGTCTGTTAACAGAAATGCAAGCTTGGAGGTCTTGAGCAAGAAGTTTGGCGTCAA
CCCGAGCTCAATCCGCATGTACTTGCACTACCAGCCTACGTACTATCACCTACACGTGCACTTCTCGCACGTCAAGATGACCCAGGGTATGTGGACTCAT
TATCTCCGCGTCTGCGTGGAAACTAACATTCTATCTACAGGAACGTTTTCGGGCAAAGCTGTGCTGCTTGAAGACGTGATCTACAACCTGTCGGTCAATA
GCGACCACTACAAGAACGCGACGCTGTCATTTGTGGTCGGTGAGATGCAGCACAAGCGGCTCTTCGAGCTCTTCCGCGAGAAACACATCATTTAGTGCAG
GCCAGTGTCAACTCGGTGCACTCTCCAACGTGCTTGCAAAGCATAACCCTTTGCAGGCTCATTTTGCGTTGGTGCGCATACTTAGTAGTTGCTATGAATG
GAGCATTGTAGACGAACGGGTGCCTCATCTTCTTCATGGATACACTCGCCTTACAAATTCCTTGTCTAAATCCAACGGCGGAACGCACCCCTCCATCGGC
GGAAAATAACGGCCGATGTTCTCAGTGCTGAATTCGCTCCCGACCAGCAGAGAACAAATCCCAGCATGACTCTCCTCGAGAAGCTTTTGGGCGCCACGTT
GGTGTCGAGGCGCGGTGAGACGTCCACGCACGAGGCGCTAGCGCACAAGTCGGTGGTGGGGTTGTACTTCACCGCCAGCACGTGCCACCCATGCCGAGCC
TTCACGCCCGTGTTGGCGACTGTGCACCGTAACATGACGCTCAACGCATACAAGATGCTGCCCATGAAGGACCAGCTGGATGTGGTGGTTCTGTCCGTGG
ACCGCAGCCCCGTGGCCTTCCACGACGCTCTTCTGCAGACGCCGTTCCTCGCCGTGCCATTCCACCGTCGTGAAGTCGTGCAGGACCTGTGGAAACGATA
CGACGTGAAGAAGATCCCGGCGCTTATTTTCGTGGACGCCAACGGCGACGTGATCGAGCGCGAAGGCCGTCGCTTCGTCGAGAACAACTACACGGACCTG
CGCAAGATTTGGGAGCACCTCGCGCCTTCTTTCTCGTCGTCGTCGGGCCCGGAGGCTGCCAGGCCGTGATGTTCGCTTCTAGGAAAATTGCATACCCCAT
CTACCGCGATAAGTACCAGGTTAGGCTCAGTCGATTAAGCTTTTCTATTCTCTTTGCTTCACCTTCGTTTTGGAATGCTGCTTCATGGTGATCCGCTACA
CTACCGGTAGAGCTGCAAGGTCCAGCTGTAGGTGCCAGAGTGCGAGATCCTAACGCTCTTGTAAGGTGGGTGGTGGCGTGTTTGCTCGGAGTCCATGTGG
AGCATTTCACGGTCTCACCATACTGCAAAACTACACATGGATCGTGGCGTGGTTGGTGACATGCCGCTACAGATGTAGTCAGACCTACTGGAAGCGGATC
CTGCATCTGAAGTAGATAATCGTAGGCAATTGTTTATACTATCGCTTGAGGCTGAAACCACTTTAACAGATACCATTGCAACAATTGACGGAGAAGAAGC
TTTATCTCTATGGTATAGACTCTTCCTGCAATACTAAGAGAGCAATGCCGACGGCACCAAACCCATAAGCCATGTTGAAGTCTGTTATAATTCCTGTGAG
CCAATCGCAACATTTTACTTTATCGACAAAATATATTCATCCAATCACCGCGCGAGTAGGCAGTACGTACTTTAGCCGTTGTACACGCATCATGTCGCTG
AGGCTTCCCACAGCGCTGAATCAGCAGTCCTCCGTCGGCGCACTCTGGAATTGGCGGCACCACACCCAAGGCATTGACACCAGGAGTGTCGAGTCCAGCC
ATGCCTCCTATCTCAGCAACCAGCAAATCTCGCGGCCCTGTACTGGCCAAGTCCGTGGACGAAGACGAAGTCTATGGCACATTCAACGGCCGACCGCTTC
AAAGCACAAACATTCGAACATCCAGCAATGGTTCAAACTCCAGAATCGGTGCTTTGATGCGTGCTATTGCAGCCGTGGGGTTCGTCCTGTTGGCCGCAGG
ATACATCACCAATTCCGACTCCAGTGCCGTCCAAAAGGTTGCCGAGTCCTCCACAGTCAATGCAGATACGACGGAAGTGCCGGTGACCGACTTTCATCAG
CAGTTTGTCGACAACGTAAACGCTGGCAGCATGCGCGAGTACCTTCACACGTATTCGAGTGTCCCGCACAGCTGCGGTACCGAACAAGACTACAAGACGG
CGCTGTTCACGGCGAAAATGTTCCAGTCTTTCGGCATCAAGGCAGAGATCAAAGAGTACTACACGCTGCTTTCGACACCGGTTCGTCGTCACTTGTCGAT
CGTAGAGCCTGTTGAAGCTGCTCGCGAGCTGAATTTGACGGAAGCTTCGGTGCCGGGCGATACGTGCACGAGCGATGATAGTGCGTTGCCTCCATTCGTG
GCGTATGCTGCGACGGGAAACGTCACGTCCTCGATCGTGTTTGTGAATTTCGGCAAGCAAGCAGACTTTGAGTGGCTTGTGGGCAACAATGTCACGCTCG
AAGGTAAAATCGCATTGGTGCGATACGGTGGTAACTTCCGCGGACTGAAGGCTATGGCAGCAGAACAACATGGAATGATCGGTGTGCTAATCTACTCGGA
TCCCAAGGAAGACGGCTTCGTTCACGGCCCAGTGTACCCCGACGGCCCGTGGCGCCCTGAGGGATCGTTTCAACGTGGTTCGCTCACGTACCTTTCGCTC
GCTGGAGGTGACCCGATGACGCCTGGTTGGGCCTCTACGGAGGGCTCTTACCATATTCCGTATGAAGACGTGAAAACAATTCCCCACATCCCCGCGCTGC
CACTATCGTATGGTCAGGCGCAATACATTCTGCAGGCTCTGGGTGGCAGGGAGGCTCCAGCTTCGTGGCAAGGAGGTCTCTCGTTGCCTAACGGCTACCG
TATTGGTGATGATGAGGCGATGGTAGTAAATCTGGACATTGAAATCGATAACAAGGTCGGGCCGATCTGGGATGTCATCGGTACAATTGAAGGCTCTGAG
GAACCTGAGCAGCTGGTGCTGTTGGGTAACCATCGCGATGCCTGGGTTTGTGGAGCAATTGACCCTAACAGTGGTTCATCCACTCTTCTCGAAATCGCAC
GCGGATACGGCGAGCTGCTCAAGCAAGGATGGAAACCACGGCGTACATTGATTTTGGGCTCATGGGACGGTGAAGAGTATGGCCTCTTGGGGAGTACCGA
ATATGCTGAAGAAAACGCTGAGCTCTTCAAAAAGCAGGCAGTGGCATACCTGAACGTGGATTCTACGATGGGTCCGTTAGTCAGCGCCAGTGCTAGCCCA
GCCATCGCGGAATTTCTCTACCAAACGGCCAAAGACGTGCCAGCAAACAAGTTCCATGGCAACGAAACGGAGAAAACACTGTATGAACAATGGACTAAAC
AAGCTGCGGCTCATCGCGAACAACTTCGCGGGGCAGTGATGGGACACTCGGTCCAGAGCATTTGATCAGCTTCATGGGTTCTGGCTCGGATTACACGGCG
TTTTACCAGCATCTCGGTATCATCTCGGCCAATTTGGGCTTCTCGCTCGCGCGGGCTCCCTACGGAGTTTACCACAGCTCGATGGACAGCATCATGTACT
CGGAGTTGTACGGCGATCCTAACTACGCCACCCATGTCGCCACTGCGCAGTGGTGGGGTCTTCTAGGCCTGCGTCTTGCCGACGACCAGGTTTTGCCATT
CGACTTCACTACATACGGGTTCGTCATGGCGGAAGACTTGGCAGGTCTAGAGCAGCAGGTTGCCACGCTGCCGCGCTCCAGTGTAGATTTCAGCGAGCTG
CACCAGGCCATTGATCGATTCACCACCAGTGCCACCACCTTCCACGCGCAGCTTGCCGCGTTCGCGTCCAACGAGACCCTTGCGGGCAACGTTGATGCTC
TCCACGCGTGGAACGAAAAGTTGGTGCTGCTAGAACGTCACTTGATCACCAAGGATGGTCTGCCTCACCGTCCGTGGTACAAGCATGTGATCTTTGGCCC
AGGGTTCTACGAGGGGTATGCCGGGGCAGCTTTCCCGGGCATTTCGGACGCGATTGCATTCTATGATGACGCCGCTACCATCCAAAAGCACGTTGACGAC
GTGGCTCGCATTGTGAACGACGCTGCTAACTATTTGTTGTAGACATTGAGAGCAGCAGTGTGGTTTACAACACCAACAAGTTCATCTCTTTGAAATCGTT
GTTCTCGAGGTTTTCTAAGACCAACCGACTAATCGTCACACGTCGAAAATATGTTCATGCGGGTCATGGAATTGCTGGGGCAGTTGGAGTGTCTTGAGGT
TGGTGTCGCGCTGGTGGTAACAGTGCTGAATGTCCTTTGGCTATGGCAGCAAGCAGGTGCAAGCACCAGCTCCAAGCGGCTGCGTGGTTTCAACCTCGTC
AAGACAGACACGGAGCTGGCGCTGCTTGGGACCTTCAGGAGCGACAACAACAAGAATGAGGCGGTGCTTGTCATTCAAGCGGCGGAGATGGACACGGGCG
ACCTGGATCGAATGCTAGCAGGAATGTCATTGCATGAAATTATGAAGAACGACATCTACAGCACATTCCAAGGAGACGTATCGCGCGATGTCAAGCCGTA
CAAGGTGTGGGCCGAGAAGAATCAGGGAAATATGTCGAAGTACAACGTATTGTGGTAATCTGTTTTGCTGCACAGGTTAATTTAATCTACCCAGCGACCG
AGGCACACGTGCATAAGCATACCGACCAAGGCTTTCACATGGTGGTGGAGACGAAGGAAACGTACCAGACAATCACGAAACTTTCGTCAACAGTATAAGC
TCGAGTGGGTCTACACCATACTGGACCAGTAAGTGGGGAGAGAGTTTGATATTTAGAGTTAGCAGTAAGCGTGACGTATTGATCAGTGTGCTTGCTTGAT
GCAACAGCAAGAACGAGACAGAGCGGATGATTTACGAGGACGCAAGCCCTCGAGATGGATACATCTGGCTGCCAGACTTCAAATGGTCGGATCCGTCCAA
TGTACGTCTTACTTTGCAGTTTGCTGCTGATTATTTGATCAATACGGACAGTTTTGATGATTTGCTTCTTTCTTCCGACACAGTTGGAGTCACTCCACTG
CCTTGCAATTGTGCACGACCGTTCTCTTCGATCTCTCCGTGATCTTACCAGCTCTAATTTGAAATTGCTGTGGAACAAATTCGGTGCGGGCCAACTCTTC
CCTTTACCTCTGTGGTGAGCTATTATAATTCTTGCACAAACTCATGTGCACCTTTGTGTGTTCTTGCAGAGAGATGCGAGCTTGGAGGTTTTGAACAAGA
ATTTTGGAGTAAACCCAAGCTCGGTGCGCATGTACTAGCACTATCAACCGACGCACTACCCACCTGCACGTGCACTTTTCACATGTTAAAATGACTCACG
ATACACTTTCGCTCCACCGCGGCTTTCAGGGCTCTTGCGATTTATTGTGCGCAGGAACATTTCGAGCAAGGCTGTGCTACTTGGAGACGTGATCTACAAC
TTGTCGGCTAACAGTGAACACTACAAGAACGCGACGTTATATTTTGTGGTCGGCGAAATACAGCATAAGCCACAGCTCGAGAAAAGGGCATCATTTAGCT
AGCCAAGCGTCCGCTTCATTCATACTAGTCAATAGTGTAGCCATATCTATTGACTTAAGTGTACTAAGCTTATTAATAATTAAGCTTGCCAATGAGTCAT
ACAAAAACGTAACGAAGCTCAGCTGCTGTTCATTTTGTAAGTTGAGTTGAGAGTCCCACCATGGATACCTCTGTATTGGCGCCTGCGACGCAAGAGGTTT
GCTTACAGCTCTAGCTCTAAATATTTGATACCGTATGCACACTACGAGTGGTTGACTAACGTGTTACGCCGTCGTTGTTACCTTCAGGTGCTCAACGATT
TACTGACCGAACGCGGCCTCACCGAGTGGCAAGTCGTGTGTGACGTCCACGTCTCCGTCGAGCCCAACGAAAGCATCGACATAATCTACGGTTGCGCATT
GGCGACAAGTCTTCAAGAAGAACGCATCGATCGCAAGCGCAAGCGGAAACCGGCCAATGACAGTGAGCGACCGGCGTGGAGCTGCTTCCTCGTGCTCCAA
GCCGTCTTCTGCTCCCTCAGCATCAAGAGGTGCGTCAGCTGCCTACAGCCCTTCTCTTGTATTTACTACAGACCGTAATCTTGGTATTGTTTCTATTGAA
CGCAGGCTTCTAGAGCTGCAGCAATGCGCCGACGCCAATGAACCACTGAGCACGGTCTCAACAGCCACGAAGCGAACGTTCCTGTGCCTCACAAACGCCG
CAAGCGTTAGGTATGCCCCCACTGCATTCCACAATGAATATGCTGCTGTCTGTGCTAACCTACGGCCCTTAATGCTGCATGGACGCACTCGCAGTTACTA
CTCGCTCCAAGCTCCAGCCATCCTACCCTAGGCGTCGTCACTACCTCTTTATAGTGACATAATACATTTCATCAGTCAATGGTTGAAGTTCATAACAATG
ACCTTCTAAACGGTTTGCGCAGCAGGAAGCGTGGAGCACTTCAGCTTTGTCCTGATACGGTCCGCACCTGCGTATCCGTCACCTTACGGCGTTTCAATGC
GTCTCCCAATGCTCTTCACGTTACCACGAGGCTCCCTGTTGAATACAGGACGCAACAAGCTGCAGGGTCGCTGCGTGACGACTATCGCCACTGGCCCGTC
GTCTTCGACAAAGAGAGACCGTCCACTACCCCTCGAGGGCATCCGAGTGGTGGAGTGTGGCCACCTCATTGCAGGCCCCTTTGCGGGTACAATTCTGAGC
TACTTTGGTGCAGACGTAATCAAGGTGGAGTCTCCCACGGGAGATCAAGTACGCGACTATCGTGAGCTGGACTCGACCAAGACGTCGCTGTGGTGGTACT
CGCTTGGACGCAACAAGCGCTCGGTGTCCATCGATATGAAGAAGGAGGAGGGTCGGGAGTTGATCAAAGAGCTCATCGAGCAAAGCGACGTCTTCATCGA
GAACTTCAGGCCTGGCCGCATGGAAAAGTGGGGGCTTGGGCCGGACAACTTCGAGGAAAACAACCCTGGACTAGTGTACACTCGGGTGTCTGGATTCGGA
CAGGACGGTCCGTACTCGTCCAGACCGGGCTTTGCGTCAGTGTGTGAAGCTATGGGCGGCTTTCGCTATGTGAATGGCTTCCCGGATCGCCCACCTGTCC
GCCCGAACCTCAGCGTTGGTGATACACTGGCTGGGATCCACGCGGCTCTCGGCATTGTCATTGCTCTTCTTGGCCGTGAGCGCGGTGCCGCTGCCGGGCT
GAACAGCAAGGGGCAAGTTGTGGATGTGGCTATCTACGAGGCAATGTTCAACCTGATGGAGGCTGTAGTTCCAGAGTACAGCTATTCGGGAAGTGTTCGT
GAATGTTCGGGGTCAACCATTACGGGTATTGTGCCTTCGAACACCTACGTCACCAAGGACAAGAAGAACGTCGTCCTCGCTGCTAACACTGACTCGCTGT
TCGTGAAGTTGATGAACGCTATCGGGCGAGAAGATATGGCGGCGGACAGCAAGTACCGCACGAACGCCGACCGCGTCGTTTACCAAGCCGAGATCGACGC
CGCAATGGTGGCCTGGACCGCTACCCAGGAGCTGAACACGGTGGTTACCGTGATGGAGAAGGCCACTGTGCCTGTCGGCCTCGTGTACTCTGTGGAGGAC
ATGGCCAAGGACCCGCATTACCAGCACCGTGGAATGTTCGAGGAGGTCGAAATCCCGGACGGAGACGGCACGCGCAAGCTCCAGGTGCCTGCGATCTTGC
CAAAGCTAAAGGCGACGCCGGGTGAAACGCGGTTCGCTGGTCGCAGACTGGGGCAGGACACACGTCAGGTGCTGGAGCATGTTCTCGGGCGGTCCCAGCA
GGAGATCGAGCGGCTGCTGGGTGAAAAGGTGGTGTTTGAGCCGTCTGTGTAGGCGTGTCAGAACGAGGCATAGGGCGACAATGCAATCGGTAGACAAACG
TTTGTGAATCACTCGCTGACAGGATTGCATCGTATTGGTATACGGTACTCCGGAGCAAATGGCAAGAATCACGAGAGATCACCGCGCTCTATCTACATGT
ACGTGGCCAGGTTTGTAATAAAGCTCTTCAATCGATAGGCATCCGCATCACTTGGACCAATAGCCTATCATTGCTGCCTTTGCCAACTGCAATTGCATCA
TGGCCTTTGTATTCGAGAGAGGACTCGCGCTCAATGCAGCGCTGTCCTCCACCCACAATAACACGATGGCAGTCTGGTAGTCGCGCAACGGCTCTGCGGT
GTTCATCACGTCGAAATGGCTCGGCCTCCGACGGCATCCGCGTTGTGATGCCGCTTGTCCGCTTGTGACACAAGCTGTGGTGCCGCACCTGGCGCGGGAA
AGAGGTGGTCGCCGTGTTGCCGCCTTCTCTGCACAGCCAGGCCCACAGCCGTCGGACAGCACCACGGGACTCCAATACGCTGCAAAAAGGCAACTACTAC
ATGTAGTTTTGATAACTGCAGTCTACATACATGCACTGGTGCCCTGCAACCTGGTTCAGCCAGCGGATTCCCGGCTCAGAATGGCACCAGGTGATCACGC
CCCGAGGCTGGTCGTTGTTAACGCCAGATGGAGCACCCGCAAAACCGACTCGATTATCAGTTATCGCAGGTTTCATCCTTCGGTGCAAGCGATTACGCGG
GGTATGCACTTTACACACACTTTTCCGCGCATAATCCCTGCTAACCTCCGTCTAACAGACAACATACCGAAGGCAAAGGCAGCCGAGAGACCGCGCCAGC
GTCTCGCGTCCTGCCCCCTTCCTAGGCCCGACATCTCCGTCTCCTTCTCCCATACCCTTGCCACCTGCTTCTCGAAGCTTTGAGCGCGTCGCAGACGAGC
GGTACGCTAGCTCTCGCCCCCAAACTTGCTCCGCGTTTGCACTCATTGTTCTGTGCTCCCAGAGGCCAGTGGAGAGTCCGAGGACCTTCTGCACACACAG
AGGCGGCCGTCCTGCGCCTACATGGGATGCCAGCACCCGACGACGCGCCAAGTGAACAGACCGCAGCCGCTAGGACCAACAGCAGCGGCTACGGCCTCCG
ACCAGCGCCCAGCTCCTCCATCTCGGGCCTCGGTAGCGTAACCAGCTTCAGGTCCAGCGAACTAGACGCACAGGAGGTGGACGTGGACGAGGAGTGCGCC
GACAGCGACATCCTCGAGGACCCGAACGACGGGGAGATGACCATCATGAACGACGACGACGCCGAGTTAAGCGAGGAAGAGGAGGAGGTCATGGAGCACT
CCATCGACTTCTCCGTCAACAGGGCCACGGTCACACGCGCGGGCGTCATACCGTGCTGTGTCTTTGTGGGAAGAGTGAGGTGGGGCACCACGGACTGGGA
GATCTACTTTGGCCAGAAACAGCTCCTACGGCTGCATTTCAACCTGCATCTCTATTGCCTACTTAACCGACACAAGGTGATGCGCGGGGTGCATCTGCCG
TGGACGATTTGGCGTGAAAACGAGCGGAAAAACGCGTGGCCGATGTGTACGTGGTACAGGACTACATTCGGGGACTGCTGAAAGACAGAGACTTGCGCAA
CTCAGAGCCGTTGTTGTCCTTCTTGGAAGTCAGTCCGTCGCGCGCAATGTTGCGTCTTGGACCTTCGCTGAAGGAAGGGTATGTGCACATGCGCATCAAC
GGACCATTCCAACTGCCGCTGTACACGTGCTTTAACCGCACCATCGAGGCGCTGTACCGGCATCTGTACCGCGCGTGGATGCGCATTGCGTTCGTGTCGG
CAATTGTGGGGTTCATTTTCCCCGTCTTTCTTGTGATCGTCACGAGTCTTCCGACGTTTTTCTCGCCGCAGAAGGAGCTGGTGAACTCGGATTCCGGCAC
CAAAGAGGTATCCACGAAACTCAACACGGCTGGTGTGTTCTTGGGTCTAGCTGTGCTGGGAGGCATCTTCTTCTTTGCTGGATTCGTGTACAAATTCTTC
CAGCATCGGCTTGGTGTCATTCGGCGATGGGTCGTGTTGAAACCTTCGTGCTTCGCGGCCTATAGGAATCGAAATGACCGTGAGCCCAGCGAGGTTTTCT
TGTTCGACAAGACTTTCACAGCAAGAAAAGGAAGCTACAGACAAGGTGTAAGCTGGATGCCAAGTGGACTGGTTGTTGGAAGCAAGGCTGGAGATATCGA
AATTGACACGGGGCACTACTACACTCGATTAACAGCTTTCGTAGCTTTGATGGGGGTCTGCTACGGAATCATGCGTCTCTCGAATAATATCTACGATTTC
GAGAACCTTACTCTGAACAAGAGTCTAGGCGTTCCCATTGCAAACGCGTCAGGTTATGAAAATTGGACGCAAGGCAACGACATTGAGTACTGCGGCTACT
ACTTCACCGTGCCTAACGGTGTCACGGTTTACGTTGAGAGTGATGACGACGGCGCAGTGATCTCGCAGCTGCAGATGCCATCTGCAAACTCGATGACGGC
GAATCTTGGATACTTCTGGCAGAGTGATGACAGCATGGGCTACAGCCTAAACGTGATCACAAATGCGGTCGGAGGCGGTACGATGGTGAGCGTGGTGAAA
CCAATTGATGTAAAGAATGATCGCTTCTTTGAGTCTGGCACGAATTACTCGGTGCCAAGTGTTGGTAACTTGACGCTGGAGGGCGTAGGCACTGACCTCA
GTGTGCAGAGCTTCAACAATGTTGACAGTCTGTGTGCGATATCGGTGCGTATTTCGCCCCTCTCGTGGCGATCATACGTCTACTACGTGTTGTTCCTGTT
TGCTGGAGGTATTGTTGCGCCTGTGGTGGGGTTCCTAGCCAACTATTTCGTCACATACCTTGGATTGTGGCATCCGCACGTTCGACGAGATCATTGGTAT
CGATGTGTGCATCGTCTCCAGAAGCTCAAGCGGCAAGAAACGTCTACGCGATTCAATTCGTTTGCTCCACAGCACACTAGCTCATTGGATGATGACGATT
CTGCAGCAGTTATCGCCAAGACAAAGGCGGCCAGTTTACCCGTTACCAACACCAACGGCACCGCTATTAATCAAGTGGTGGATTCAGTGATCAAGTTGGA
TACAGAGACTGCTGTGCGGATGGGAACTGGAAATCTGGCACCAGCCTCTGTTCGAATTGACAGCAGCACGCAATCTGAGGAGTCGTTCGAAGCTCCGTCG
CCGCCACCCAGCGCTGTCAGCTGGCATGTAGATGCAGAAGATACTTACGCAGCCATGTTTAAGGCAATCTCCAACGCCAAGTACGAGATACTAATTGCCG
GTTGGTGGGTGTGTCCTGACCTGTTCTTGCTTCGTCCCGGTCGAAAATTGCCGCCACGTGAACCAAACGAAGATCCCAACGGGCAGCAAGTGAACAAGTC
GCAACTTCGCCAGTTGCTGACGAAGAAAGCGGAGGCCGGTGTCAAGATCTACGTGCTTATTTATCGTGAAGTGAAGTTGGCTCTCACGCTGAACAGCGCA
TACACCAAGCGCAGTCTGATGCTTCACCCGAATATCCGCGTCCTCCGTGATCCAATTTTTCCAGATTCAAAGTCTTGGATTCTGGTCTCACCACGAGAAG
ATCGTTTGCATCGACCAGTCGCTAGCGTTTGTCGGTGGTTTGGATCTGTGCTTTGGACGGTATGACCACCATGGGCACCCAATCAGCGACCCCGGAGATG
ATCCTATTTGGCGAGGCAAAGATTACTCTAACCCGATCATCAAGGACTTTGTACGAGTGAACAAACCGTTCGAAGACCTGATTGATCGATCTTCGCAGCC
TCGAATGCCATGGCACGACGTTCATTGCAGCATTTCTGGCCCACCTGTGCAGGACGTGGCATTCCATTTCATCCAACGATGGAACTTTGTGTGCTCCAAG
AATGACTATCAACTACGAACAGGCTGGTGCATTTGCTTTCGCTCTCGAAGATTTAAATTCCTGCCGAAATGCCTTGTGCCGATGGATTTTAACGGATGGA
CGCTGCAGTATCCGTCTTCAGACCCTGACGTGCGTGACGGCTCAACTCGTACAACCATTCCACTTGTACGCGAAGACTCTCTGAGTATGGAGCCCTTCCA
AGTGGTTCAGTCTGTAAACGCTATGTACCCCTGCGCCGCAACGGGTCCTCAGTGGCTACCAACGTCGTCGTTGCACCCTCTTAACCCCTTGCGCCCGATT
GCGAATGAATCGGCGACTACCGGGCCCTTAGACGATGGCGAAGTGCTGCGTGCTCAGCGTGGCGAGTCTATTCTGCAGGTGTTCCACCCGAACGCCAATA
TCTGCAACATTCAGGTGTGCCGCTCAGTATCTATGTGGTCGGCAGGCGTGCCTACAGAAGCCAGCATTCAAGTCGCTTACATGGATGTGATTGCGAACTC
GAAGCACTTCTTGTACATCGAGAACCAGTTCTTCATTTCTGGAATGGACGGGAATGGCATCGTGCGAAACCGGATTCTGCAAGCGTTGGTGGATCGGATC
GAGCGTGCTGTGCAGCGTGATGAAAAATTCCGAGTTTACGTCGTGATGCCGCTGCTGCCTGCATTCGAAGGCAACGTCCGCAGCCACGAGCTCACAAATC
TCCATGCAGTCATGCACTGGCAGTTTGCTACAATTTGCCGTGGGCGGTACAGTCTTTTCGAGGCGCTGAAGGGCGTAACAAATCACCCCGAGGAGTATGT
GGCGTTCTTTGGACTACGCAAGTACGGTATTATGCCGAACGGATGTGTGTCCACCGAACAAATCTACATCCACAGCAAACTTATGATAGCTGATGACCGA
TGCGCTATCATCGGCAGTGCGAACATCAACGACCGCAGTATGAATGGTGACCGTGATTCGGAAATCGCCCTGGTGATCGAGGATATGCAGTATGAGGACG
GTGTGATGAACGAGAAGCCGTACCGACGCGGTCTGTCAGCCAGCAAGCTCCGCATGCAACTTTTCCGCGAGCATTTGGGACTTGGCGACGATGATCTCTC
CATCGTAGATGCGACGTCGGATCACACGTGGAAGACCATCAAGTCTGCTGCTTCAACCAATACGAAGATTTTCGAGAGCGTGTTTGACTGTGCGCCTTCG
AACCGCATGCGCGCGTTTGTGAACTTTCAGAGCATTGAGGTGACGCAGATTTTCGAGAACCAGCGTATGAATGTGCTGAAGGTACCGGGTCGATCTCATG
TATGGGATGCTGCCAATCTGAAGGATGGCGACTATGCGCCATGGACCGATGTGAATGGTGTGCCCATCGCGGCAGACCGTGTGGACCTGAGAGACTTCGA
AGTTGATAACTACAAGGACAGCAAGGACAGAAAGAAGAAGCTGTTCTCCATGGATCACGATGGCTGGTGCTACGCGCGAAACTTCTCTATCTTCCAGGAG
GTTCGCACCATGAAAACGGACTATAGAAAACGCGAAAAGTTACAGCATCTCGTAGCCGACAGGTTGATGGCCCAGGTACGACGTCGGCGATGGGTGAAAA
AGGGTTTTATGCCCCCACGACCTGATCCCCGCGAAAGCTCCTTCAGCATGGCCAGTGACGACGAGGAACACGGACGATTTTACTCGATCTGGCGAAGGCT
TCAGCAAGGTGATTTCAGTCGCTCGAACTCCATCAGCATGACTCCGACCAATTTCAGTCAGATGGACACTGGTAGTGGAATCGCTGGCAGTGTGAGCGTC
GGAGGCACCAACCAGCGTCGTCTGCACAATTCGGTATCGATGCCATCCGGTAGTTCGTTCTTGGTTGGGGACAGTACGCCGCTGCAGCCTGTGGTGCTCG
GAGATACGCCATCTTATCCAAACTCGCCCAGTGTTTCGAGCTTCCAGCAAACGCCTCAGAGTCCATCAGTGAATGCACTCGTTGGCGGTCCACGGAGTGT
TCGCAGTGCGCGCACGTCGTCCCTCCTTGGAACTGGTGGTGGTGTCCGTACACGTGACAACACCCGCAGTGCTCGAGGTAGTTTCTACGGTATGTTCAGT
GTTACTGGAGGCAATCGCCAGCTCGATACCGATGACGATTCCAGCGATGCAGGAAGTGACTACGGAGGAGGCCACGGCATCCGCGCGTCGCTCAAGCGGT
GGTACTCCACGATGGATGTGCTGGACTTCGGGCGTCGCTCCAAGTTCAACGCGGAGTACTTCGACGCGGACGAGGACCATATCAATGGAGAGGATCCGCT
CCTTGAGGATGGCCGAGGCAGCTACCACGCTGCTACTCGCGAAGGTCTCCTAACCGAGGAAGTCGCGGATGAATCTGGTGGAGAAGACGCTGATTGCCAG
ATCAGCCACGTGCAGACTGCAGCTACGGTTCGCAAGGAGGACGAAACGCGCGCTCGTGGCCAGCTCTCGGAGATCCGCGGCCACCTCGTCGAGTTCCCGC
TGGACTTCCTGGTCGAAGAGATCCTCAAGCCGTCTGTGCTGCCTGCCGACATTCATATTTAAGCAAGCGACGCTGCGTCAAGAGTAGCGATAGACACACA
ACAACAAGGAGGTCGCACGGCCAAGCGTACAGATAGATAGTTTCGGCCCGATTTTATTTGCGTTTATGCAATTTAGTTTGAATTTGAAGTTTTCGTCATG
TTCGTGTTCGAGGCAATTGACAGCGGTGACCTGGCGCTTCTGGACGTGGCCACAAAGGCCCAGCTGCCGTTCGACGAGTATGTGGTGGTTGCTGGACGTG
TGCAGAGCTCGCGGCAGCTCACGTGTCTCGGCGGACGTGTCAAGCGTGACGGAAAGCGGCGGCTACTGGTCGTCCCGTTAGCTCAAGCGGAGGCTGCCGG
AAATCCGAGCGTGCAGGTGCTGGACGTGGGCGAAGTGGCCGTCAACTTGTTGCAAGGAGTGCGCGCGTGCTTCCCGACGCTGGTGAAGAAGAATCCGTTG
GCAGGTCTACCCATGGACGACAGCAGCGACTCGGACGAGGAAGATGGAGATGCGCGCAAGAAGCAGAAGCACGACGAAGATGCAAACCGCCCTGTTGACT
CCGAGGCTGCAAAGACTCAACAGCTGATGGCGGACGCTGTTGAATACATGAGCCAGACACGCGTGAAGGTGCTCGCGACGCTGGACGAGCTGTTTAGTGC
CTTCCAGATTGCAGACCCGACGAATGTGCTGATGTCGCTGCGCAACGATCCGTCGCTGCCCAAGCACTGCCAGTTGCTGTGTATGGACTGTCCTCCTCTC
GGTACTGTGGAGAATGGAGCGCATGGCGCTGTGTCGCATGCTTTCTCTTCATCTTCAGGTCCGCCAGAGCCCTTCAACTTTGGCGTCTTGTTCTCGGAAG
TGGCGACGAGCAAGGGGGAAGAACAGTTTCTGCATATTCCAGTGCCGCGCTCACCGCCTCTACCAGCGCCAGGAGCTCAAGGAGAAGACTACATGCAGGA
GAGTTTCCAGGATGCCACGGTGCTGACGTTCGGCGCCAAACGCGAGGCAACTGCGCATGGCGGGGGCAAGACCTGCGAAGAACTGGTGAAGAACATCCGC
ATGCGTCACGCATCGGGCACATTCTGCACGCTCGTACTTCCCACGAAGACATGGGAGGAAGTTGTTGAAGAGCACAAGGCGTTCCTTCCCCAGGTGTGTG
AGCTATATGGCGAGTTGCGGCAGCGTCGTCTCATGGGCAATGCTCCCTGCGGTGTCCCCATCGAGCTGCTACTTGAAAACTGAACGAAATACGCCACATC
CATTGCAACAACATGCTGAATGAAGAGATACACAGGTAGGTCGTCTCGAACCCCACTTTTTGAATGGAAAATGTAGTTGCTCGTCTGCATGCCTTACTGT
GGCCTGCCACTGAGGCACATCCAGTAGTCGTTCTCCTTCAAAATGGATCCGTCCTCGTTGTTCGTGGCGCGTGGTGTCCTCGCTCCACGCGGGTTCTTCT
CCGGCCGCCAGAGCCACTTGGACGGGATGAGTCCGTCAAGCACGTCTTCGTCGTCGCCCGCTTCGTGCTCGTTGTACGACGTGACCAGCAGAGGTACTTG
CACCTCTCCCAGCACGAGTCTGATAGCCGGTAGCCACTCGTCGTAGCCCCAGATACCAGCATTGAAGCACACCACGAGGTCCGGCGCGCAGTACAGCGTC
TTGTCCTCGAAGTAGGCCTCAAAGCCGCCCACGAAGTAGCTCACGTCCACGTGTCCCGTCTCGGCTTCATCAAAGCTGAAGCTTTGCAGGTGCAGCTTCC
TGGATAAATTAGGCCCCACGAGCACCAGTTTGAGCGTAGACAGGTGGGTCTCCGTGGCCACGTACTGCGAAAAGCTCCGGAAGACGTCGAAAGTCTCAGC
TCCCGAGTTGCCCTCGCGGTGATCGGCGCCCAGCAGATGCACAGTCAGCGACTTGCTAAAAGTGACATCACCACTGTGCGCGTGTTGCAGACGCTTGATC
CACTCCACGAGCGTCGCGGCGCGGGTCTCACAGGCGGATGCGAATGCCATCGCTGTCGTTATTGGCACAACCTAGTATTGGTGGTCGCGGTAGCGTTTTG
TAGGAAGAGCTATCTAGATTAACCTATAGAATTGAATGCCTGCGGTATAAAACTTCAGAAACGACGAACGATCGTATTCGTTGCACGTGGCGGCGATGCT
GGCACCCGATACGACGTGGATGGACACGGGCAGCTACCCACACCGCTATCTCTATGTGGCGTTCGCCATCTTCCAGTGCTTTCTGGGCGCTGGGGTCATC
TTCGGCTGGTACCGGGGGGGCGACATTTTGGTTCTTTTACATCTTGGTGTGACGTTTGCATTGCTGCGTGATAGGACGTCGCTGGTGCCGTTGCTGGAGA
AGGAGCGAATCTACAATGAATTCTGCAAAACTGGAGAAACCAGTACGTGGAGCAGGCAGAGTCGGAGGTGCTGATGTCGAGCTGACGGAGGAATTTCTGT
TGTTTGACTGCAGTCTGTACGGAACAGAGCGACCGTCTCCAGTATGCCTTCACGATGGCAGTCTCCAGCAGTATGTGGTCCAATCTGCTACTCGGCCTCG
TATTTGACAAGTGAGTACTGCACATTGCTGCGACTTGAATTGTTAGAATTATGAAGGCGATGCTCTTGATTGACTCGAGAATGCGATGCGCTTGTAGATT
CGGACCCCGCGTGACGAAGTCGCTTTCGCTGGTGTTGTTGATTAGTGGCGCTTTGCTCATGGGCAATGCTCACTACAGGTGCTTTTGCTCGTTGGTTGGG
ATCTCTCCACGACTGCACTTTTGACAATGTTTACATTGTTGGTTTTCTTATCAGAGTGAACGCTGGAGGACACGATTTGTTGCTTTACGGAATGGTGCTT
GTCGGGTTCTCGGGTCCGGGCATCCAGCTCTCTGGTATTCATATGTCCAACTTGTTCCCCGAGGCAACGGCGCTGGTTGCGTGCTTCATCGTCGGAGGTC
TTCAGCTGAGCTTCTTGATTTTCACGCTGTTCGACCTCGCATACGAGCACCTCGGGTTGTCCATGTCCACGGTCTTTACGATGTACGCTTGCGTCCTGTT
CCTCTCGCTCATCGGCACACTACTGACGGAGCCGGACACGCCGTTCGAGGTCGTTCCCAGTGAAGAGCACGAGCTCCTCTCGCCCATGCGTCTGCCTTCC
GTGTTCAAGGAGGAGGAAGCCTCGCTGCTGATGTCTACACCTGAGTTAGAGAAGTACCGGAGACGCCATCGTCGACCAACTGACGAGGTTTTCTTCGATG
GGGATCTTCACAATCGCTCATTCAGGACGCAGGTGCTGTCCAAGCCGTTCCTGCTTATCGCGTTCTACTTCTCTATCCTCTCTCTTTGGTGCAACTTCTT
CATTGGCAGCATTACAGGCCTGCTTCGGTGGAAAGGTCTCCCTGAGAGCGTGGTGGCCAACTTGCTTGGAAAGCTGGCGTTCGTGCTGCCGGGCAGCGTG
ATGTTCATCCCTTTCGTGGGATACCTACTGGAGAAGTGCGGGTACACGTACTCGTCGTTGGTGTGCACGGCGGTGGCGCTGTGCTTCACGGTCATGTTAA
GCAGCATGTCCACCGGGTGGATCGTGGCTGGCTTCGTGGCGTACGCGTTCTTCCGGACCATCATGTTCCCGCTGCTGTTCGCGTACCTGGGCCACCGCTT
CGGCTTCCAGCACTACGGGGCGCTGTCGGGCATTGCGTTCTGCATCGGCGGCGTCGTGGGGCTGTTGCAGACGCCCATTGCTGCCATCGGCGACTTCCAG
ACCATCGGTTATGTGCAGGTGAGTGCGTGGTTTGCTTCTGATTCTGGTCCGAGAGGATCGGCATTGGTGGATCCATCTTCTGACTGTTGTGCTGTGGGTG
TTCGTTCGTCTACTGCTTGCATCGGACCCCGTTATAATAGTTGGGACACTGCTGCTGACCTTCGTGGCGCCCTACTTTGAGCGTCAGCGTGACGGGTACT
ACTAGCGCAATGGGGCGTGTGTTCTGTGCCTCTCCAAGCGCGACAGGCGCAATGCGAAACAGACCGGAAAACCAACGCACTCGCCGACATCGGTCGATGC
AAGTCCATTGCCCGCTGACTCGAATGCGCCATGACTTCCTCGCGCGTGTTGCTGTCGAGTTGCCGTGCTTGGTGGCCGATCATGTCGCGCGCACAACCAA
GCGAAAGTAATTGAGCTCAACCTTCCGTGTTGTGGCTTTCGGACCAGGAATTAGTATTATACAGATGGTGCCGAGTGTGAAGACTTCGTTTCTGCTGTTG
TTTGTAGAGAATATTGCTGCTATTCTTGTGATTTTCGGACAGCCGTTTTTGGAGGTACCTACCCCGAGGAGCTGATCTTCCCCAGATGGCTGCACAGCTG
AAACCATCGCAAGAAAAACACGCAGCCTTCCCCACCCTATAATATTAAGTTTACATATGAATCGATTCACTTATGTTCCCGTCACCCCCAATTTGTGTCC
TAGTCTACATACATAAATTTAATTATCTATTCATATCGTTATGTGAGGGTTGTGAAACAGCTGTATCACTCTTCGCAGACTTCAAATGTACCATTCCCTG
GGTACAACTCAGTTTGCGGGGCGCCTTCCCCACTCATTAGCCATTTCGCCGAGCTGTGACGACTCCTCTCTCGCTCAATGTCGCTCTTCTCGCTCCCCAG
CGTCCTACGCCGCAGCGTGCCGTCCGACGGCAGCGACAGCGCGCCGGCCGTGCGTCCATCCGTCATCAGCACCAGCCACCTGAATGCGCAGCTCCTCGAG
GAGGCCAAGCACGCGGACCAGCACTTGTTCTTCGGGCCGCAGCAATCGGTGTTCGACGGTGAGCGCCAGCGTGTGATCCACGGCGAGCGCAAGATCCAGA
AGAACACCAAGCGGTTCTGGCTCATGTCCGAGCCGCTCAGCATGGACCGTGACAGTACCACGTCGCTCATTGGCTTCCCCACGGAGCAGACGCGCGCCGG
TGGAATCGGCAGCAAAGTGACGGCGGCCACGCGCTTCCTGGGTCAGAAGGTGGCGCAGATGAAGTTCCCGGCCTCGCACGTGAACGAGGACTCGTTCTGC
GACGGCTGTGGCATGGACCCCATCGTGGGCAACATGTACTCGTGCTCCAAGTGTGTCAACTACCACCTGTGCGAAGGCTGCTACCAGCTGGGTATTCACG
GCTTTGAAGAGTCCAAGTTGCTGCTCGACGTGCGCGAGGACTTTGCCCTGCGTAAGGTCATGGACGTATGCAAGAACAAGGTGCCCGAGGAAGTCTTCAC
GGTGCTGCTTAAGACGGTGTGTCGCGGACAGGTGGACAAGTTCAACTTCCTGGCCAAGTGGATCACGGCCGTCGTGCTCGGCCAGCCCGTCAACTCGCTC
GAGGTGCGCGGCATCGAGATTCCGCACCTCGACTCGGAGACGCGCGCGACGCTCGTGCAGCTGCTCACCCCCGTGCTCGCGGACCGCACGGACCTCGAGG
TGTGCATGGAATGGTTCTGTCCGGTAGGTTTTCTTGTTCTTGAAGCGTTCGGCGAAGATGGGACTGATTTTTTATTGCTGGCTTCTTGATGATGAATTAG
GACGCTGATAAGATGGACCTGCCCGGTGTACAGCGCCGCATGGAGACCATCCGGATCTGGGTGGCCACCGACAAGGACCAGAAGTCGCCCTTCGCTACCA
AGGATGGCCTCAAGGACGAAGACACCGAGTCGGACATGTCCCCGACTAGTGGCAATGGAGATGTTATGGACTCGCCTGGCCCCGCCAGCCCCGTTTCGAG
CGTCAAAGAACCGGAGTCGCCGGGCGCTACGCCGCCTCCGTCGCCCAGCGCAATCCGCCGCAAATCCACGGGAGCGACATCCATGACGTCCGAGTCATCG
TCGCAGGCCTCTCCTCCGCGTCTCGGTGCACTTTCACTGGCTGACAAGACTGCCGAATACAGTTACGAGGACGAGGACGAGGACTACATGTCCGACTCGG
TTAAGAGCGACATTGAGCCCCGGAAAGTGGACAGTTTGTCGCCCTCCTCCGGTCACCGATCGGAAGGCATTGAGATGTAAAAAGAGCGAGGGGAGGAGCG
AGGAGCGGACAAGATGCGACTGTGAATGGGCTGCTACTCAGTGCAAGCCGTAGACACAGCGGGTCAAGTGCGCGTTCTTGGTCTTCCTTCATTTTGTTAT
TTTCATTTTCGCTTTGCTTTCACCAAATGTAAGAAGGGGTTGCTAGGATATATAAAAAATCATCTTCATCCACTGCGTTCACGTTCAATGAAGCTGGTAT
AAGAAACAACAGATTCGAGAAGTGTCGATTAACCTTTTCTTCTCTTCTTCGTGAAGACGGCAAGTACAGTACCCGTATCTCGTGTCTACTCGGCTACGTG
CTCGCACGAAACCATTTGCACAACGGATATTTCACTCGTCGGCAATTTGTCGTGCGCTCTTTTATCATACCCACGCGCTCGCATCCTAGTTCTTGGCACG
GTAGAAGGTAAGGTAAGCCATGTGCCAGTCACCCCCGCCCTTGAGCTTCATGATGTCCTCTGTCTTGCACGGCGACACATCGTCATCATCGTAGCAATAC
CAGTCGTCTATCATTGCACAAAACACGTTATCAGCTTCTTCGTCACCTGACGCGTATGATGAATAAACCACCGTGTGCTCACCTCCTTCATGGCGCACCC
AAGCCATATAGTGACCAGAATCGGCCGAACGACCCTTGTGCGTCAGAATAGCGAACAGTTCGTAGTTTCCCTATGTCAAGCACAACACGAACGTAAGCAT
AAACCATCCAACCACATACACAAAGCACACTAGGCATCAAATACGTACTTGGAAGTCAATAGGAAGGTCAATACCAGGAGACTTGGCTCCCATCGAAAGC
GCGCGAGCAGTCTCGAGAGCCGCTCTGTCCTCCTCGGACAGCCCGTCCATAGCGTCATCCTCATCAGCCTCTTCCTTCGTCTCTTCGACGTCCTCCTTCT
TCTCACCTGCAGGTTTCTGCTAAGTGAAAGCGGTACATCAAGCAAGAACGTAATGAGCGTGAGTTCTCCTTTCTCAATTACACCGCACTGTGATACCGCG
TACGTACGTCCTTGAACTCGTTCAAAATCTTTCGGCATTCCTGTCACGGGAGATCTTCATGGTTGCCTGTAGCTCGTCAGAGCAGAAGTCGAAGACATCC
AGTGTCGTGGGGAAACTGATAGGCTGCAGAACCAAACGTGTTCCGTCAATGGACGTGCCTAACAAGCGCAAGGAAATACTTTCTTTACCCGCAGCATTTT
GCACTTGACACCGGTGTGGTCGCGGCTCTCCGGCGTCGCCTTCCAGTAGAAGCGCATAAACTGTACGCACAGTACTTGGGCAGGCGTTTATCCGAAGCGT
TTTCTTCCACACCGCGTTGCGATCCAGCACATCCGAGTGCTTCTCAATCGTTCCTTCCAGTCCCTATTCACCAATCACATCTTCAATAAGACACCCAATC
TCCATCCCAACCCAAATCAAAGCAACAATCATAAAACTTACAATCTTGATGCCTTCGGACAGGTGGTTGGTCTCAATGGTGATGTTGCACACGAGCTTGA
GCGCCTTCTCCTTCTTCAAGACGGGGGTCTCCATCTCGCTCTCCGTGCACTCAATTTTCTCATTCAACTCCAACCCAAACAACGCGTCCACGACGTTGCT
CGTGGGTCCGAGAGTCTTTAGTGCCCCCGCGGGTTGCGTCAGCGTCTGCTGCAGCGTCGCAAAGAGCGTGGACAGGAACTCCTCGCTGTCCTGCTGCATG
TACCCGCCACTCCTGGGCGACTGCTGCGCGAACTGCGGGTACGCGCGACGCAGCACGGACACGAACATGGAGGGGGTGATGCTGTCCACGCTGCCATCCA
GCTGTGTGTACATGTCCTTGAGTGCAGTAGTAAAGTTGTTGGCCAGGTCAGCAGACACGCCACCCGCCTGGGCCTTGAAAGCCTCGCGCAGCTCCTTCAC
GGGCCGCAAACACTGGAGCGTGGCGTTCATGTAGCACGTATTGCCGAGGTTCACGAGGCCTGCGGGATACACTGTGCCAGTAGCTGCGATATCCTTGGTG
GTCATGTCCTCAATGAAGATGATGGGCTCCTTGGGCTTGTTCACCACCTCGGCCGATCCCATGAGCATGACACCTGTGCCGTCCACGAGCTTGTCGAGCG
TCGAGAGGTCCACGTCGTCCTTGAGCATCCCCTTCCAGGCCTTGGACATGAGCTTCTGGCGCTCCACAGGCACGGACGTGAGCGCGTACAGCTGCGCCTT
GAGCACGGCCACGGGAGCTGACTTGTCCACCGCCACGTCCTTGAACACCTGCTTTCCCCATTTGACACTCACCTGGGCCGTCATGACTAGCGTTGATCCT
TGGAGCTCTTGTTGGACTGTGGGGGGATTGAAGATCGCGACCTCGAGAAGCTTCATTTGATTGGCAGAAAACATATTATACGGCTGATGATTGGTGGAAT
GTGATTACGAAATCAATGTCGAATTTTGGAAATTGGATTCGTAGAGATTCGCACATGGCTACATGCATGCACTGCTTATAGATCTTAGGATACTTTCTTC
TTCGCTTAACGTTTTGGCACCTCTCATCCCGCTCGGTACTTGGATGTCGTCAAGGCGACCGTATCACGCAGAATGGCGTCGCCCGTCGCCTGGTCTTCGA
ACCACTGCATGCTCGCGTGAGTGCGGTTGGCCACATTCAGTAGCGAGAAGCCGTAGTCAGCTTGCCGGAAGGCTGACCACTCCGGCTGCGGGTCGAAATA
CGTCGGTGCCAGGCCTTCGCGGTTGCCGGCATCGCCTAGCACAACGTACACGGGGGCGTCTTCAACGACCTTCTGCTTGTACACTGGGTGACTGCGCTCG
TAAGCGTGGACGTGTCCGGAGACGACGACATCCACCTTGTTCCGGTAGAGAATATCCTCCATGTTCTTCTTCATGATCATGTGTGGCTCCATGCCCTGGT
GCGCCGTGTTGCTGTTGTACCACGGCCCGTGCATGATTACCACCAACCACGGGGTGACGCTGCGGTCGACGCGCTGGAACTCTTGCTGCACCCACTCGTA
CTGCAGCGAATCGGGAGTCGAGTCGACGTACGGCGTCAAGATGACGAAGTGCACCAGGCCCACGCGGAAGCCGTAGTACAGGTTGCGACGCTGCAGCTGG
TCCGTCCGCTCGTACGGCATACGGAATCGCGTCTGGTACGCGACGAACTCGCTCACTTCGCGCTGACAAGGCCGCTCCATCTCGTGATTGCCCGCTGAGA
TCATCCACGGCATCCGGGCAATCAGCGGCTCGACGAGCTTGCCCCACCGATCCCAGCGGTACTGCTCACTGTCGGCGTACGACAGATCGCCAGCACACAC
GATCATACTCATCTTCGACTGGAGACCAGCGAGGTGGCGAATTGTCTCCTCCGAGTACTCAGTTTGACTAGAGTAAAGAAACAGCTCGATTAGAATCAAG
AGCGTTATCCTCAGCATGCATTGTAACACAGTAGCTTACCCGAGGTCACCAATCACGCCGAACGTCTGCGGGGCCTCACTGCCGACAGGTACAGCCGTCT
TGAATGAGTACACAGGACTCCACCCACCCGTTTCATCACCGCACTGGTCTGTACAACACACACACAGTCAGCCTTTCAGTCTGACACAACGTACACCACT
ACTACATACAGTAGTAAGTCGTGTCCGCAACCAACTTGTCGCCGGGGATCGTCACATGGTGTAGCCACGGCGACGTGTACGTGCAGAAGTCGTACTGCTC
GCACGGTTCCTCGGCCTGCTGCACGGTCGAAAGGGCGTCCTTGTCCAGTCCGTAGCGCACCGTGGACTTAGTCGTCTTGACTTCCGTCGCCCAGGAGACG
GTCATGCCCAGCCTCAGCTCCGAGGCTGCAGCGTTTGCATTGCGGATGGCTGCGTAGCTCTTCACGGCCATTTCACCGGCCAAGGCGACGTGGATCTGAG
CCGGCGGTGCAGCGTTTGAGGGCACCGCGAGCATTGAAGTGGCGTGGCTCAGACTCTCGTCGTACACCGGCACGCGGAACATGTTGACTAGCACAAAGGC
TGAGGTGAAGAGCAGCACAGAGATGCCGAGGATCGCCATCCTGGAGTGTGTCGAAGATGGTTTTATTTCGAGAAGAGGCGCGCTCGAGTTCTTCCGCCCG
GCGTTGGTGGTGCGAGTGTTCGCAGAATTGACTCGTGGGCGAATCGTCGATCCGTACGAGACTACAGCCACAGGGTCGGGGACAACAGCCAGAGTGGCTT
CATCTTTGTGTCAATACGAATGGAAAATGAGGGATGCCTTGCCCATGAGAGCCGAGGTGCAGGCAGATTCAGAGCGCTGGTATCCTGGCAATGGAGAGAA
TCTTCGTCCTCCGTGAGAACCGGCCGCGATGCTGTTTGTATTTGCAGAGCACCAGATGGGATCGTCCTCCAAAGTGAATCGGGCTTACCAAAAATCTCTT
GTGACGTGTTCGAACGCAACATAAGATTGGACCAAGACACCTTGAACACTTCAGCTCCACACGGCCCGCCTAAATACTGCAAGTGACGCATGACCAAGAA
GTGACGAACCTCTCGACAATGTGGTGCATTGTTTACAGTTCATG