Description :
From Genome Similarity Track
Location :
contig_24:607908- 635052
Transcript NameFunction/comments
g5484.t1hypothetical protein
g5485.t1hypothetical protein
g5486.t1RAW32557.1 putative glutamate carboxypeptidase [Phytophthora cactorum
g5487.t1XP_009529764.1 hypothetical protein PHYSODRAFT_302387 [Phytophthora sojae
g5488.t1hypothetical protein
g5489.t1hypothetical protein
g5490.t1XP_009529772.1 hypothetical protein PHYSODRAFT_560562 [Phytophthora sojae
g5491.t1XP_009529774.1 hypothetical protein PHYSODRAFT_560567 [Phytophthora sojae
g5492.t1ETL94500.1 hypothetical protein L917_07560 [Phytophthora parasitica
g5493.t1POM58505.1 Iron(III)-zinc(II) purple acid phosphatase [Phytophthora palmivora var. palmivora

Sequence
27144 bases(100 bases per row)
CATCGTTCTTGGACTGCAGCGGCGGGTCTTCCAGGGCTGCGCGCACCGCCTCCTCGTTCTTGCGCTGGGCCAGCAGCCCTTGTACCTGTGTGGCGCGGGC
CTGGACGCCCGCCGCGATCTGAGTCTCGTTCACCGCCATCTTGCTCCTGCTCTTTTTGTATGTGTCGCAAAGGACCGTGTGCAATTGTCACCAAACTTGC
CAAATCCGGTGATCGGCTTTGACGGGGAAGTGAAGCGGCTTCAACTTGACCTTATTATCAGATTTCGCGTGCATTGCAATTCGGTCACAAGGAATTGGGA
GTGATATTACAGTAAATAAAGGAGGAGGAGCTCTGGAAGTGGAAAGGTAAAAAGCTCGGTTGGAATCTGCCATCAACTTGCTGGCCAACGCATTGCAGCG
AGTTTACATGATGCTGCAAAAGATCGGAATCGGCAAGACGCTGTATGAGCGGCCACTGCTGAACACGCCAGCAAAGCAGAAGGAGAGCCCAACAACAAAA
ATCGTCAGCACCTACCCACTGCAAGTAAGCAATCAATACCCAACACGTACACGATCACTGGTCGGCGGTGTTCCATCAGAATCTGGTTCTGTGCGCCGCA
CACTGTGCACTGGAATGTCGAGCCGTGGGTCACGTTGCGCACTACATGCGTCGTACCACAGTTGCCGCACTTGTATGGCATCTCAGCCTGCGGGACTGCC
TGCGCGACCGCCACCATCGGATCCTGGTCGTACTGAGTCTGCAGCTGACGCGCCACCTCCTCGTCGCGGGAAGTGTCATTCTACAGCAGATAGCAACGTC
CATAGCGTCAGCTCCGAGCCCGTCGGACTCAACCATCATTGTCAGTTACCTGAATATTCATCGAGACCTGTTGGGCACGCGGGATCTGTGGGTACAGAGG
CTTGTCGCCGCCTGGAGTCGCCATGGTTTGAGTCTTCTTTCTTGGTCTCAATTCAAGTCGCTTTGGACTCAGAATTTCTTCCTTGCGACTAATAGCCAAT
CAGATCTTGAGATGCTACTGACGGCACTATCCCAATCAATTTGTAGCAGAGACGATGGGGTTGCTAGAGCTGCTGGGGCAGGTGGAGCGTCTGGGGGTCA
GTATTGCCCTCGTAGTGGCAGTACTGGGAGGGCTTTATCTGTGGCAGCAAGCGGTGGGGGTGTCGGGATCACCAAGATGCTGCGGGACTTCAACCTCGTG
CGCGTGCTCAAGCGCACGGACACGGAGCTGGCTACTGGGCAATTTCAAGAGCGACAACCACAAGAAGGCGGCGGTGCTGATCATCCAGACGGCGGCGATG
GATACGGGAACTTTGGGTCAGTTGTTGACGGGGCTGTCACTGCATGAGATTCTGGTGAACGACATCTACAGCACGTTCCAGGGAGACGTCTCGCGCGATG
TCAAGCCGTACAAGGTGGTGATGCTGAGAGGGATGAGAGGGGGGGGGGGTGACGGTGTAATTTACATTGTTTGTGCTTTTGTTTGTTTGTATTTGGCTAG
GTAAATTTGATCTACCCGGCGACGGATCGACATGTGCGCAAGCACACAGACCAACATTTCCACATGGTGGTGGAAACCAAGGACGCGTATCGGATGATCA
CCAAACCGTTCATTGACAGTATCCCTGCGGAAAATATTGAGTGGGTCTACAATATCCTGGACCAGTAAGTGTGCTGGAACTGCTGCTCTGGTGCGTGCTA
CGTTGTGTAGCGTATTGACCGGTGTGTGTGTTTGATGGAACAGCAAGAGCGAGACGGAGCGGATTATTTACGAAGACCCACACCATCGCAATGGGTTCGT
TTTGCTTCCCGACTTCAAGTGGTCGGACCCTTCCAAGGTGAGTCCTGCGTTCTGTAGTCTGGTGCTGTCAACACAATAACCCCGTGATGCATGCTGACCG
CTGGCTCCTACGTTGACTTTAGTTGGAGTCACTGTACTGTTTAGCCATTGTGCATGACCGCTCGCTTCGATCACTTCGCGATCTCACTAGTTCACACTTG
AAGTTGCTCCGAAACATCCGGTAGGCTCAGTTTGTTATCAAGTTTTTTTTTGGATCCGGCAAAAGCTCACGTTTGTCTGTTAACAGAAATGCAAGCTTGG
AGGTCTTGAGCAAGAAGTTTGGCGTCAACCCGAGCTCAATCCGCATGTACTTGCACTACCAGCCTACGTACTATCACCTACACGTGCACTTCTCGCACGT
CAAGATGACCCAGGGTATGTGGACTCATTATCTCCGCGTCTGCGTGGAAACTAACATTCTATCTACAGGAACGTTTTCGGGCAAAGCTGTGCTGCTTGAA
GACGTGATCTACAACCTGTCAGTCAATAGCGACCACTACAAGAACGCGACGCTGTCATTTGTGGTCGGTGAGATGCAGCACAAGCGGCTCTTCGAGCTCT
TCCGCGAGAAACACATCATTTAGTGCAGGCCAGTGTCAACTCGGTGCACTCTCCAACGTGCTTGCAAAGCATAACCCTTTGCAGGCTCATTTTGCGTTGG
TGCGCATACTTAGTAGTTGCTATGAATGGAGCATTGTAGACGAACGGGTGCCTCATCTTCTTCATGGATACACTCGCCTTACAAATTCCTTGTCTAAATC
CAACGGCGGAACGCACCCCTCCATCGGCGGAAAATAACGGCCGATGTTCTCAGTGCTGAATTCGCTCCCGACCAGCAGAGAACAAATCCCAGCATGACTC
TCCTCGAGAAGCTTTTGGGCGCCACGTTGGTGTCGAGGCGCGGTGAGACGTCCACGCACGAGGCGCTAGCGCACAAGTCGGTGGTGGGGTTGTACTTCAC
CGCCAGCACGTGCCACCCATGCCGAGCCTTCACGCCCGTGTTGGCGACTGTGCACCGTAACATGACGCTCAACGCATACAAGATGCTGCCCATGAAGGAC
CAGCTGGATGTGGTGGTTCTGTCCGTGGACCGCAGCCCCGTGGCCTTCCACGACGCTCTTCTGCAGACGCCGTTCCTCGCCGTGCCATTCCACCGTCGTG
AAGTCGTGCAGGACCTGTGGAAACGATACGACGTGAAGAAGATCCCGGCGCTTATTTTCGTGGACGCCAACGGCGACGTGATCGAGCGCGAAGGCCGTCG
CTTCGTCGAGAACAACTACACGGACCTGCGCAAGATTTGGGAGCACCTCGCGCCTTCTTGCTCGTCGTCGTCGGGCCCGGAGGCTGCCAGGCCGTGATGT
TCGCTTCTAGGAAAATTGCATACCCCATCTACCGCGATAAGTACCAGGTTAGGCTCAGTCGATTAAGCTTTTCTATTCTCTTTGCTTCACCTTCGTTTTG
GAATGCTGCTTCATGGCGATCCGCTACACTACCGGTAGAGCTGCAAGGTCCAGCTGTAGGTGCCAGAGTGCGAGATCCTAACGCTCTTGTAAGGTGGGTG
GTGGCGTGTTTGCTCGGAGTCCATGTGGAGCATTTCACGGTCTCACCATACTGCAAAATTACACATGGATCGTGGCGTGGTTGGTGACATGCCGCTACAG
GTGTAGTCAGACCTACTGGAAGCGGATCCTGCATCTGAAGTAGATAATCGTAGGCAATTGTTTATACTATCGCTTGAGGCTGAAACCACTTTAACAGATA
CCATTGCAACAATTGACGGAGAAGAAGCTTTATCTCTATGGTATAGACTCTTCCTGCAATGCTAAGAGAGCAATGCCGACGGCACCAAACCCATAAGCCA
TGTTGAAGTCTGTTATAATTCCTGTGAGCCAATCGCAACATTTTACTTTATCGACAAAATATATTCATCCAATCACCGCGCGAGTAGGCAGTACGTACTT
TAGCCGTTGTACACGCATCATGTCGCTGAGGCTTCCCACAGCGCTGAATCAGCAGTCCTCCGTCGGCGCACTCTGGAATTGGCGGCACCACACCCAAGGC
ATTGACACCAGGAGTGTCGAGTCCAGCCATGCCTCCTATCTCAGCAACCAGCAAATCTCGCGGCCCTGTACTGGCCAAGTCCGTGGACGAAGACGAAGTC
TATGGCACATTCAACGGCCGACCGCTTCAAAGCACAAACATTCGAACATCCAGCAATGGTTCAAACTCCAGAATCGGTGCTTTGATGCGTGCTATTGCAG
CCGTGGGGTTCGTCCTGTTGGCCGCAGGATACATCACCAATTCCGACTCCAGTGCCGTCCAAAAGGTTGCCGAGTCCTCCACAGTCAATGCAGATACGAC
GGAAGTGCCGGTGACCGACTTTCATCAGCAGTTTGTCGACAACGTAAACGCTGGCAGCATGCGCGAGTACCTTCACACGTATTCGAGTGTCCCGCACAGC
TGCGGTACCGAACAAGACTACAAGACGGCGCTGTTCACGGCGAAAATGTTCCAGTCTTTCGGCATCAAGGCAGAGATCAAAGAGTACTACACGCTGCTTT
CGACACCGGTTCGTCGTCACTTGTCGATCGTAGAGCCTGTTGAAGCTGCTCGCGAGCTGAATTTGACGGAAGCTTCGGTGCCGGGCGATACGTGCACGAG
CGATGATAGTGCGTTGCCTCCATTCGTGGCGTATGCTGCGACGGGAAACGTCACGTCCTCGATCGTGTTTGTGAATTTCGGCAAGCAAGCAGACTTTGAG
TGGCTTGTGGGCAACAATGTCACGCTCGAAGGTAAAATCGCATTGGTGCGATACGGTGGTAACTTCCGCGGACTGAAGGCTATGGCAGCAGAACAACATG
GAATGGTCGGTGTGCTAATCTACTCGGATCCCAAGGAAGACGGCTTCGTTCACGGCCCAGTGTACCCCGACGGCCCGTGGCGCCCTGAGGGATCGTTTCA
ACGTGGTTCGCTCACGTACCTTTCGCTCGCTGGAGGTGACCCGATGACGCCTGGTTGGGCCTCTACGGAGGGCTCTTACCATATTCCGTATGAAGACGTG
AAAACAATTCCCCACATCCCCGCGCTGCCACTATCGTATGGTCAGGCGCAATACATTCTGCAGGCTCTGGGTGGCAGGGAGGCTCCAGCTTCGTGGCAAG
GAGGTCTCTCGTTGCCTAACGGCTACCGTATTGGTGATGATGAGGCGATGGTAGTAAATCTGGACATTGAAATCGATAACAAGGTCGGGCCGATCTGGGA
TGTCATCGGTACAATTGAAGGCTCTGAGGAACCTGAGCAGCTGGTGCTGTTGGGTAACCATCGCGATGCCTGGGTTTGTGGAGCAATTGACCCTAACAGT
GGTTCATCCACTCTTCTCGAAATCGCACGCGGATACGGCGAGCTGCTCAAGCAAGGATGGAAACCACGGCGTACATTGATTTTGGGCTCATGGGACGGCG
AAGAGTATGGCCTCTTGGGGAGTACCGAATATGCTGAAGAAAACGCTGAGCTCTTCAAAAAGCAGGCAGTGGCATACCTGAACGTGGATTCTACGATGGG
TCCGTTAGTCAGCGCCAGTGCTAGCCCAGCCATCGCGGAATTTCTCTACCAAACGGCCAAAGACGTGCCAGCAAACAAGTTCCATGGCAACGAAACGGAG
AAAACACTGTATGAACAATGGACTAAACAAGCTGCGGCTCATCGCGAACAACTTCGCGGGGCAGTGATGGGACACTCGGTCCAGAGCATTTGATCAGCTT
CATGGGTTCTGGCTCGGATTACACGGCGTTTTACCAGCATCTCGGTATCATCTCGGCCAATTTGGGCTTCTCGCTCGCGCGGGCTCCCTACGGAGTTTAC
CACAGCTCGATGGACAGCATCATGTACTCGGAGTTGTACGGCGATCCTAACTACGCCACCCATGTCGCCACTGCGCAGTGGTGGGGTCTTCTAGGCCTGC
GTCTTGCCGACGACCAGGTTTTGCCATTCGACTTCACTACATACGGGTTCGTCATGGCGGAAGACTTGGCAGGTCTAGAGCAGCAGGTTGCCACGCTGCC
GCGCTCCAGTGTAGATTTCAGCGAGCTGCACCAGGCCATTGATCGATTCACCACCAGTGCCACCACCTTCCACGCGCAGCTTGCCGCGTTCGCGTCCAAC
GAGACCCTTGCGGGCAACGTTGATGCTCTCCACGCGTGGAACGAAAAGTTGCTGCTGCTAGAACGTCACTTGATCACCAAGGATGGTCTGCCTCACCGTC
CGTGGTACAAGCATGTGATCTTTGGCCCAGGGTTCTACGAGGGGTATGCCGGGGCAGCTTTCCCGGGCATTTCGGACGCGATTGCATTCTATGATGACGC
CGCTACCATCCAAAAGCACGTTGACGACGTGGCTCGCATTGTGAACGACGCTGCTAACTATTTGTTGTAGACATTGAGAGCAGCAGTGTGGTTTACAACA
CCAACAAGTTCATCTCTTTGAAATCGTTGTTCTCGAGGTTTTCTAAGACCAACCGACTAATCGTCACACGTCGAAAATATGTTCATGCGGGTCATGGAAT
TGCTGGGGCAGTTGGAGTGTCTTGAGGTTGGTGTCGCGCTGGTGGTAACAGTGCTGAATGTCCTTTGGCTATGGCAGCAAGCAGGTGCAAGCACCAGCTC
CAAGCGGCTGCGTGGTTTCAACCTCGTCAAGACAGACACGGAGCTGGCGCTGCTTGGGACCTTCAGGAGCGACAACAACAAGAATGAGGCGGTGCTTGTC
ATTCAAGCGGCGGAGATGGACACGGGCGACCTGGATCGAATGCTAGCAGGAATGTCATTGCATGAAATTATGAAGAACGACATCTACAGCACATTCCAAG
GAGACGTATCGCGCGATGTCAAGCCGTACAAGGTGTGGGCCGAGAAGAATCAGGGAAATATGTCGAAGTACAACGTATTGTGGTAATCTGTTTTGCTACA
CAGGTTAATTTAATCTACCCAGCGACCGAGGCACACGTGCATAAGCATACCGACCAAGGCTTTCACATGGTGGTGGAGACGAAGGAAACGTACCAGACAA
TCACGAAACTTTCGTCAACAGTATAAGCTCGAGTGGGTCTACACCATACTGGACCAGTAAGTGGGGAGAGAGTTTGATATTTAGAGTTAGCAGTAAGCGT
GACGTATTGATCAGTGTGCTTGCTTGATGCAACAGCAAGAACGAGACAGAGCGGATGATTTACGAGGACGCAAGCCCTCGAGATGGATACATCTGGCTGC
CAGACTTCACATGGTCGGATCCGTCCAATGTACGTCTTACTTTGCAGTTTGCTGCTGATTATTTGATCAATACGGACAGTTTTGATGATTTGCTTCTTTC
TTCCGACACAGTTGGAGTCACTCCACTGCCTTGCAATTGTGCACGACCGTTCTCTTCGATCTCTCCGTGATCTTACCAGCTCTAATTTGAAATTGCTGTG
GAACAAATTCGGTGCGGGCCAACTCTTCCCTTTACCTCTGTGGTGAGCTATTATAATTCTTGCACAAACTCATGTGCACCTTTGTGTGTTCTTGCAGAGA
GATGCGAGCTTGGAGGTTTTGAACAAGAATTTTGGAGTAAACCCAAGCTCGGTGCGCATGTACTTGCACTATCAACCGACGCACTACCCACCTGCACGTG
CACTTTTCACATGTTAAAATGACTCACGATACACTTTCGCTCCACCGCGGCTTTCAGGGCTCTTGCGATTTATTGTGCGCAGGAACATTTCGAGCAAGGC
TGTGCTACTTGGAGACGTGATCTACAACTTGTCGGCTAACAGTGAACACTACAAGAACGCGACGTTATATTTTGTGGTCGGCGAAATACAGCATAAGCCA
CAGCTCGAGAAAAGGGCATCATTTAGCTAGCCAAGCGTCCGCTTCATTCATACTAGTCAATAGTGTAGCCATATCTATTGACTTAAATGTACCAAGCTTA
TTAATAATTAAGCTTGCCAATGAGTCATACAAAAACGTAACGAAGCTCAGCTGCTGTTCATTTTGTAAGTTGAGTTGAGAGTCCCACCATGGATACCTCT
GTATTGGCGCCTGCAACGCAAGAGGTTTGCTTACAGCTCTAGCTCTAAATATTTGATACCGTATGCACACTACGAGTGGTTGACTAACGTGCTACGCCGT
CGTTGTTACCTTCAGGTGCTCAACGATTTACTGACCGAACGCGGCCTCACCGAGTGGCAAGTCGTGTGTGACGTCCACGTCTCCGTCGAGCCCAACGAAA
GCATCGACATAATCTACGGTTGCGCATTGGCGACAAGTCTTCAAGAAGAACGCATCGATCGCAAGCGCAAGCGGAAACCGGCCAATGACAGTGAGCGACC
GGCGTGGAGCTGCTTCCTCGTGCTCCAAGCCGTCTTCTGCTCCCTCAGCATCAAGAGGTGCGTCAGCTGCCTACAGCCCTTCTCTTGTATTTACTACAGA
CCGTAATCTTGGTATTGTTTCTATTGAACGCAGCCTTCTAGAGCTGCAGCAATGCGCCGACGCCAATGAACCACTGAGCACGGTCTCAACAGCCACGAAG
CGAACGTTCCTGTGCCTCACAAACGCCGCAAGCGTTAGGTATGCCCCCACTGCATTCCACAATGAATATGCTGCTGTCTGTGCTAACCTACGGCCCTTAA
TGCTGCATGGACGCACTCGCAGTTACTACTCGCTCCAAGCTCCAGCCATCCTACCCTAGGCGTCGTCACTACCTCTTTATAGTGACATAATACATTTCAT
CAGTCAATGGTTGAAGTTCATAACAATGACCTTCTAAACGGTTTGCGCAGCAGGAAGCGTGGAGCACTTCAGCTTTGTCCTGATACGGTCCGCACCTGCG
TATCCGTCACCTTACGGCGTTTCAATGCGTCTCCCAATGCTCTTCACGTTACCACGAGGCTCCCTGTTGAATACAGGACGCAACAAGCTGCAGGGTCGCT
GCGTGACGACTATCGCCACTGGCCCGTCGTCTTCGACAAAGAGAGACCGTCCACTACCCCTCGAGGGCATCCGAGTGGTGGAGTGTGGCCACCTCATTGC
AGGCCCCTTTGCGGGTACAATTCTGAGCTACTTTGGTGCAGACGTAATCAAGGTGGAGTCTCCCACGGGAGATCAGGTACGCGACTATCGTGAGCTGGAC
TCGACCAAGACGTCGCTGTGGTGGTACTCGCTTGGACGCAACAAGCGCTCGGTGTCCATCGATATGAAGAAGGAGGAGGGTCGGGAGTTGATCAAAGAGC
TCATCGAGCAAAGCGACGTCTTCATCGAGAACTTCAGGCCTGGCCGCATGGAAAAGTGGGGGCTTGGGCCGGACAACTTCGAGGAAAACAACCCTGGACT
AGTGTACACTCGGGTGTCTGGATTCGGACAGGACGGTCCGTACTCGTCCAGACCGGGCTTTGCGTCAGTGTGTGAAGCTATGGGCGGCTTTCGCTATGTG
AATGGCTTCCCGGATCGCCCACCTGTCCGCCCGAACCTCAGCGTTGGTGATACACTGGCTGGGATCCACGCGGCTCTCGGCATTGTCATTGCTCTTCTTG
GCCGTGAGCGCGGTGCCGCTGCCGGGCTGAACAGCAAGGGGCAAGTTGTGGATGTGGCTATCTACGAGGCAATGTTCAACCTGATGGAGGCTGTAGTTCC
AGAGTACAGCTATTCGGGAAGTGTTCGTGAATGTTCGGGGTCAACCATTACGGGTATTGTGCCTTCGAACACCTACGTCACCAAGGACAAGAAGAACGTC
GTCCTCGCTGCTAACACTGACTCGCTGTTCGTGAAGTTGATGAACGCTATCGGGCGAGAAGATATGGCGGCGGACAGCAAGTACCGCACGAACGCCGACC
GCGTCGTTTACCAAGCCGAGATCGACGCCGCAATGGTGGCCTGGACCGCTACCCAGGAGCTGAACACGGTGGTTACCGTGATGGAGAAGGCCACTGTGCC
TGTCGGCCTCGTGTACTCTGTGGAGGACATGGCCAAGGACCCGCATTACCAGCACCGTGGAATGTTCGAGGAGGTCGAAATCCCGGACGGAGACGGCACG
CGCAAGCTCCAGGTGCCTGCGATCTTGCCAAAGCTAAAGGCGACGCCGGGTGAAACGCGGTTCGCTGGTCGCAGACTGGGGCAGGACACACGTCAGGTGC
TGGAGCATGTTCTCGGGCGGTCCCAGCAGGAGATCGAGCGGCTGCTGGGTGAAAAGGTGGTGTTTGAGCCGTCTGTGTAGGCGTGTCAGAACGAGGCATA
GGGCGACAATGCAATCGGTAGACAAACGTTTGTGAATCACTCGCTGACAGGATTGCATCGTATTGGTATACGGTACTCCGGAGCAAATGGCAAGAATCAC
GAGAGATCACCGCGCTCTATCTACATGTACGTGGCCAGGTTTGTAATAAAGCTCTTCAATCGATAGGCATCCGCATCACTTGGACCAATAGCCTATCATT
GCTGCCTTTGCCAACTGCAATTGCATCATGGCCTTTGTATTCGAGAGAGGACTCGCGCTCAATGCAGCGCTGTCCTCCACCCACAATAACACGATGGCAG
TCTGGTAGTCGCGCAACGGCTCTGCGGTGTTCATCACGTCGAAATGGCTCGGCCTCCGACGGCATCCGCGTTGTGATGCCGCTTGTCCGCTTGTGACACA
AGCTGTGGTGCCGCACCTGGCGCGGGAAAGAGGTGGTCGCCGTGTTGCCGCCTTCTCTGCACAGCCAGGCCCACAGCCGTCGGACAGCACCACGGGACTC
CAATACGCTGCAAAAAGGCAACTACTACATGTAGTTTTGATAACTGCAGTCTACATACATGCACTGGTGCCCTGCAACCTGGTTCAGCCAGCGGATTCCC
GGCTCAGAATGGCACCAGGTGATCACGCCCCGAGGCTGGTCGTTGTTAACGCCAGATGGAGCACCCGCAAAACCGACTCGATTATCAGTTATCGCAGGTT
TCATCCTTCGGTGCAAGCGATTACGCGGGGTATGCACTTTACACACACTTTTCCGCGCATAATCCCTGCTAACCTCCGTCTAACAGACAACATACCGAAG
GCAAAGGCAGCCGAGAGACCGCGCCAGCGTCTCGCGTCCTGCCCCCTTCCTAGGCCCGACATCTCCGTCTCCTTCTCCCATACCCTTGCCACCTGCTTCT
CGAAGCTTTGAGCGCGTCGCAGACGAGCGGTACGCTAGCTCTCGCCCCCAAACTTGCTCCGCGTTTGCACTCATTGTTCTGTGCTCCCAGAGGCCAGTGG
AGAGTCCGAGGACCTTCTGCACACACAGAGGCGGCCGTCCTGCGCCTACATGGGATGCCAGCACCCGACGACGCGCCAAGTGAACAGACCGCAGCCGCTA
GGACCAACAGCAGCGGCTACGGCCTCCGACCAGCGCCCAGCTCCTCCATCTCGGGCCTCGGTAGCGTAACCAGCTTCAGGTCCAGCGAACTAGACGCACA
GGAGGTGGACGTGGACGAGGAGTGCGCCGACAGCGACATCCTCGAGGACCCGAACGACGGGGAGATGACCATCATGAACGACGACGACGCCGAGTTAAGC
GAGGAAGAGGAGGAGGTCATGGAGCACTCCATCGACTTCTCCGTCAACAGGGCCACGGTCACACGCGCGGGCGTCATACCGTGCTGTGTCTTTGTGGGAA
GAGTGAGGTGGGGCACCACGGACTGGGAGATCTACTTTGGCCAGAAACAGCTCCTACGGCTGCATTTCAACCTGCATCTCTATTGCCTACTTAACCGACA
CAAGGTGATGCGCGGGGTGCATCTGCCGTGGACGATTTGGCGTGAAAACGAGCGGAAAAACGCGTGGCCGATGTGTACGTGGTACAGGACTACATTCGGG
GACTGCTGAAAGACAGAGACTTGCGCAACTCAGAGCCGTTGTTGTCCTTCTTGGAAGTCAGTCCGTCGCGCGCAATGTTGCGTCTTGGACCTTCGCTGAA
GGAAGGGTATGTGCACATGCGCATCAACGGACCATTCCAACTGCCGCTGTACACGTGCTTTAACCGCACCATCGAGGCGCTGTACCGGCATCTGTACCGC
GCGTGGATGCGCATTGCGTTCGTGTCGGCAATTGTGGGGTTCATTTTCCCCGTCTTTCTTGTGATCGTCACGAGTCTTCCGACGTTTTTCTCGCCGCAGA
AGGAGCTGGTGAACTCGGATTCCGGCACCAAAGAGGTATCCACGAAACTCAACACGGCTGGTGTGTTCTTGGGTCTAGCTGTGCTGGGAGGCATCTTCTT
CTTTGCTGGATTCGTGTACAAATTCTTCCAGCATCGGCTTGGTGTCATTCGGCGATGGGTCGTGTTGAAACCTTCGTGCTTCGCGGCCTATAGGAATCGA
AATGACCGTGAGCCCAGCGAGGTTTTCTTGTTCGACAAGACTTTCACAGCAAGAAAAGGAAGCTACAGACAAGGTGTAAGCTGGATGCCAAGTGGACTGG
TTGTTGGAAGCAAGGCTGGAGATATCGAAATTGACACGGGGCACTACTACACTCGATTAACAGCTTTCGTAGCTTTGATGGGGGTCTGCTACGGAATCAT
GCGTCTCTCGAATAATATCTACGATTTCGAGAACCTTACTCTGAACAAGAGTCTAGGCGTTCCCATTGCAAACGCGTCAGGTTATGAAAATTGGACGCAA
GGCAACGACATTGAGTACTGCGGCTACTACTTCACTGTGCCTGACGGTGTCACGGTTTACGTCGAGAGTGATGACGACGGCGCAGTGATCTCGCAGCTGC
AGATGCCATCTGCAAACTCGATGACGGCGAATCTTGGATACTTCTGGCAGAGTGATGACAGCATGGGCTACAGCCTAAACGTGATCACAAATGCGGTCGG
AGGCGGTACGATGGTGAGCGTGGTGAAACCAATTGATGTAAAGAATGATCGCTTCTTTGAGTCTGGCACGAATTACTCGGTGCCAAGTGTTGGTAACTTG
ACGCTGGAGGGCGTAGGCACTGACCTCAGTGTGCAGAGCTTCAACAATGTTGACAGTCTGTGTGCGATATCGGTGCGTATTTCGCCCCTCTCGTGGCGAT
CATACGTCTACTACGTGTTGTTCCTGTTTGCTGGAGGTATTGTTGCGCCTGTGGTGGGGTTCCTAGCCAACTATTTCGTCACATACCTTGGATTGTGGCA
TCCGCACGTTCGACGAGATCATTGGTATCGATGTGTGCATCGTCTCCAGAAGCTCAAGCGGCAAGAAACGTCTACGCGATTCAATTCGTTTGCTCCACAG
CACACTAGCTCATTGGATGATGACGATTCTGCAGCAGTTATCGCCAAGACAAAGGCGGCCAGTTTACCCGTTACCAACACCAACGGCACCGCTATTAATC
AAGTGGTGGATTCAGTGATCAAGTTGGATACAGAGACTGCTGTGCGGATGGGAACTGGAAATCTGGCACCAGCCTCTGTTCGAATTGACAGCAGCACGCA
ATCTGAGGAGTCGTTCGAAGCTCCGTCGCCGCCACCCAGCGCTGTCAGCTGGCATGTAGATGCAGAAGATACTTACGCAGCCATGTTTAAGGCAATCTCC
AACGCCAAGTACGAGATACTAATTGCCGGTTGGTGGGTGTGTCCTGACCTGTTCTTGCTTCGTCCCGGTCGAAAATTGCCGCCACGTGAACCAAACGAAG
ATCCCAACGGGCAGCAAGTGAACAAGTCGCAACTTCGCCAGTTGCTGACGAAGAAAGCGGAGGCCGGTGTCAAGATCTACGTGCTTATTTATCGTGAAGT
GAAGTTGGCTCTCACGCTGAACAGCGCATACACCAAGCGCAGTCTGATGCTTCACCCGAATATCCGCGTCCTCCGTGATCCAATTTTTCCAGATTCAAAG
TCTTGGATTCTGGTCTCACCACGAGAAGATCGTTTGCATCGACCAGTCGCTAGCGTTTGTCGGTGGTTTGGATCTGTGCTTTGGACGGTATGACCACCAT
GGGCACCCAATCAGCGACCCCGGAGATGATCCTATTTGGCGAGGCAAAGATTACTCTAACCCGATCATCAAGGACTTTGTACGAGTGAACAAACCGTTCG
AAGACCTGATTGATCGATCTTCGCAGGCCTCGAATGCCATGGCACGACGTTCATTGCAGCATTTCTGGCCCACCTGTGCAGGACGTGGCATTCCATTTCA
TCCAACGATGGAACTTTGTGTGCTCCAAGAATGACTATCAACTACGAACAGGCTGGTGCATTTGCTTTCGCTCTCGAAGATTTAAATTCCTGCCGAAATG
CCTTGTGCCGATGGATTTTAACGGATGGACGCTGCAGTATCCGTCTTCAGACCCTGACGTGCGTGACGGCTCAACTCGTACAACCATTCCACTTGTACGC
GAAGACTCTCTGAGTATGGAGCCCTTCCAAGTGGTTCAGTCTGTAAACGCTATGTACCCCTGCGCCGCAACGGGTCCTCAGTGGCTACCAACGTCGTCGT
TGCACCCTCTTAACCCCTTGCGCCCGATTGCGAATGAATCGGCGACTACCGGGCCCTTAGACGATGGCGAAGTGCTGCGTGCTCAGCGTGGCGAGTCTAT
TCTGCAGGTGTTCCACCCGAACGCCAATATCTGCAACATTCAGGTGTGCCGCTCAGTATCTATGTGGTCGGCAGGCGTGCCTACAGAAGCCAGCATTCAA
GCCGCTTACATGGATGTGATTGCGAACTCGAAGCACTTCTTGTACATCGAGAACCAGTTCTTCATTTCTGGAATGGACGGGAATGGCATCGTGCGAAACC
GGATTCTGCAAGCGTTGGTGGATCGGATCGAGCGTGCTGTGCAGCGTGATGAAAAATTCCGAGTTTACGTCGTGATGCCGCTGCTGCCTGCATTCGAAGG
CAACGTCCGCAGCCACGAGCTCACAAATCTCCACGCAGTCATGCACTGGCAGTTTGCTACAATTTGCCGTGGGCGGTACAGTCTTTTCGAGGCGCTGAAG
GGCGTAACAAATCACCCCGAGGAGTATGTGGCGTTCTTTGGACTACGCAAGTACGGTATTATGCCGAACGGATGTGTGTCCACCGAACAAATCTACATCC
ACAGCAAACTTATGATAGCTGATGACCGATGCGCTATCATCGGCAGTGCGAACATCAACGACCGCAGTATGAATGGTGACCGTGATTCGGAAATCGCCCT
GGTGATCGAGGATATGCAGTATGAGGACGGTGTGATGAACGAGAAGCCGTACCGACGCGGTCTGTCAGCCAGCAAGCTCCGCATGCAACTTTTCCGCGAG
CATTTGGGACTTGGCGACGATGATCTCTCCATCGTAGATGCGACGTCGGATCACACGTGGAAGACCATCAAGTCTGCTGCTTCAACCAATACGAAGATTT
TCGAGAGCGTGTTTGACTGTGCGCCTTCGAACCGCATGCGCGCGTTTGTGAACTTTCAGAGCATTGAGGTGACGCAGATTTTCGAGAACCAGCGTATGAA
TGTGCTGAAGGTACCGGGTCGATCTCATGTATGGGATGCTGCCAACCTGAAGGATGGCGACTATGCGCCATGGACCGATGTGAATGGTGTGCCCATCGCG
GCAGACCGTGTGGACCTGAGAGACTTCGAAGTTGATAACTACAAGGACAGCAAGGACAGAAAGAAGAAGCTGTTCTCCATGGATCACGATGGCTGGTGCT
ACGCGCGAAACTTCTCTATCTTCCAGGAGGTTCGCACCATGAAAACGGACTATAGAAAACGCGAAAAGTTACAGCATCTCGTAGCCGACAGGTTGATGGC
CCAGGTACGACGTCGGCGATGGGTGAAAAAGGGTTTTATGCCCCCACGACCTGATCCCCGCGAAAGCTCCTTCAGCATGGCCAGTGACGACGAGGAACAC
GGACGATTTTACTCGATCTGGCGAAGGCTTCAGCAAGGTGATTTCAGTCGCTCGAACTCCATCAGCATGACTCCGACCAATTTCAGTCAGATGGACACTG
GTAGTGGAATCGCTGGCAGTGTGAGCGTCGGAGGCACCAACCAGCGTCGTCTGCACAATTCGGTATCGATGCCATCCGGTAGTTCGTTCTTGGTTGGGGA
CAGTACGCCGCTGCAGCCTGTGGTGCTCGGAGATACGCCATCTTATCCAAACTCGCCCAGTGTTTCGAGCTTCCAGCAAACGCCTCAGAGTCCATCAGTG
AATGCACTCGTTGGCGGTCCACGGAGTGTTCGCAGTGCGCGCACGTCGTCCCTCCTTGGAACTGGTGGTGGTGTCCGTACACGTGACAACACCCGCAGTG
CTCGAGGTAGTTTCTACGGTATGTTCAGTGTTACTGGAGGCAATCGCCAGCTCGATACCGATGACGATTCCAGCGATGCAGGAAGTGACTACGGAGGAGG
CCACGGCATCCGCGCGTCGCTCAAGCGGTGGTACTCCACGATGGATGTGCTGGACTTCGGGCGTCGCTCCAAGTTCAACGCGGAGTACTTCGACGCGGAC
GAGGACCATATCAATGGAGAGGATCCGCTCCTTGAGGATGGCCGAGGCAGCTACCACGCTGCTACTCGCGAAGGTCTCCTAACCGAGGAAGTCGCGGATG
AATCTGGTGGAGAAGACGCTGATTGCCAGATCAGCCACGTGCAGACTGCAGCTACGGTTCGCAAGGAGGACGAAACGCGCGCTCGTGGCCAGCTCTCGGA
GATCCGCGGCCACCTCGTCGAGTTCCCGCTGGACTTCCTGGTCGAAGAGATCCTCAAGCCGTCTGTGCTGCCTGCCGACATTCATATTTAAGCAAGCGAC
GCTGCGTCAAGAGTAGCGATAGACACACAACAACAAGGAGGTCGCACGGCCAAGCGTACAGATAGATAGTTTCGGCCCGATTTTATTTGAGTTTATGCAA
TTTAGTTTGAATTTGAAGTTTTCGTCATGTTCGTGTTCGAGGCAATTGACAGCGGTGACCTGGCGCTTCTGGACGTGGCCACAAAGGCCCAGCTGCCGTT
CGACGAGTATGTGGTGGTTGCTGGACGTGTGCAGAGCTCGCGGCAGCTCACGTGTCTCGGCGGACGTGTCAAGCGTGACGGGAAGCGGCGGGTACTGGTC
GTCCCGTTAGCTCAAGCGGAGGCTGCCGGAAATCCGAGCGTGCAGGTGCTGGACGTGGGCGAAGTGGCCGTCAACTTGTTGCAAGGAGTGCGCGCGTGCT
TCCCGACGCTGGTGAAGAAGAATCCGTTGGCAGGTCTACCCATGGACGACAGCAGCGACTCGGACGAGGAAGATGGAGATGCGCGCAAGAAGCAGAAGCA
CGACGAAGATGCAAACCGCCCTGTTGACTCCGAGGCTGCAAAGACTCAACAGCTGATGGCGGACGCTGTTGAATACATGAGCCAGACACGCGTGAAGGTG
CTCGCGACGCTGGACGAGCTGTTTAGTGCCTTCCAGATTGCAGACCCGACGAATGTGCTGATGTCGCTGCGCAACGATCCGTCGCTGCCCAAGCACTGCC
AGTTGCTGTGTATGGACTGTCCTCCTCTCGGTACTGTGGAGAATGGAGCGCATGGCGCTGTGTCGCATGCTTTCTCTTCATCTTCAGGTCCGCCAGAGCC
CTTCAACTTTGGCGTCTTGTTCTCGGAAGTGGCGACGAGCAAGGGGGAAGAACAGTTTCTGCATATTCCAGTGCCGCGCTCACCGCCTCTACCAGCGCCA
GGAGCTCAAGGAGAAGACTACATGCAGGAGAGTTTCCAGGATGCCACGGTGCTGACGTTCGGCGCCAAACGCGAGGCAACTGCGCATGGCGGGGGCAAGA
CCTGCGAAGAACTGGTGAAGAACATCCGCATGCGTCACGCATCGGGCACATTCTGCACGCTCGTACTTCCCACGAAGACATGGGAGGAAGTTGTTGAAGA
GCACAAGGCGTTCCTTCCCCAGGTGTGTGAGCTATATGGCGAGTTGCGGCAGCGTCGTCTCATGGGCAATGCTCCCTGCGGTGTCCCCATCGAGCTGCTA
CTTGAAAACTGAACGAAATACGCCACATCCATTGCAACAACATGCTGAATGAAGAGATACACAGGTAGGTCGTCTCGAACCCCACTTTTTGAATGGAAAA
TGTAGTTGCTCGTCTGCATGCCTTACTGTGGCCTGCCACTGAGGCACATCCAGTAGTCGTTCTCCTTCAAAATGGATCCGTCCTCGTTGTTCGTGGCGCG
TGGTGTCCTCGCTCCACGCGGGTTCTTCTCCGGCCGCCAGAGCCACTTGGACGGGATGAGTCCGTCAAGCACGTCTTCGTCGTCGCCCGCTTCGTGCTCG
TTGTACGACGTGACCAGCAGAGGTACTTGCACCTCTCCCAGCACGAGTCTGATAGCCGGTAGCCACTCGTCGTAACCCCAGATACCAGCATTGAAGCACA
CCACGAGGTCCGGCGCGCAGTACAGCGTCTTGTCCTCGAAGTAGGCCTCAAAGCCGCCCACGAAGTAGCTCACGTCCACGTGTCCCGTCTCGGCTTCATC
AAAGCTGAAGCTTTGCAGGTGCAGCTTCCTGGATAAATTAGGCCCCACGAGCACCAGTTTGAGCGTAGACAGGTGGGTCTCCGTGGCCACGTACTGCGAA
AAGCTCCGGAAGACGTCGAAAGTCTCAGCTCCCGAGTTGCCCTCGCGGTGATCGGCGCCCAGCAGATGCACAGTCAGCGACTTGCTAAAAGTGACATCAC
CACTGTGCGCGTGTTGCAGACGCTTGATCCACTCCACGAGCGTCGCGGCGCGGGTCTCACAGGCGGATGCGAATGCCATCGCTGTCGTTATTGGCACAAC
CTAGTATTGGTGGTCGCGGTAGCGTTTTGTAGGAAGAGCTATCTAGATTAACCTATAGAATTGAATGCCTGCGGTATAAAACTTCAGAAACGACGAACGA
TCGTATTCGTTGCACGTGGCGGCGATGCTGGCACCCGATACGACGTGGATGGACACGGGCAGCTACCCACACCGCTATCTCTATGTGGCGTTCGCCATCT
TCCAGTGCTTTCTGGGCGCTGGGGTCATCTTCGGCTGGTACCGGGGGGGCGACATTTTGGTTCTTTTACATCTTGGTGTGACGTTTGCATTGCTGCGTGA
TAGGACGTCGCTGGTGCCGTTGCTGGAGAAGGAGCGAATCTACAATGAATTCTGCAAAACTGGAGAAACCAGTACGTGGAGCAGGCAGAGTCGGAGGTGC
TGATGTCGAGCTGACGGAGGAATTTCTGTTGTTTGACTGCAGTCTGTACGGAACAGAGCGACCGTCTCCAGTATGCCTTCACGATGGCAGTCTCCAGCAG
TATGTGGTCCAATCTGCTACTCGGCCTCGTATTTGACAAGTCAGTACTGCACATTGCTGCGACTTGAATTGTTAGAATTATGAAGGCGATGCTCTTGATT
GACTCGAGAATGCGATGCGCTTGTAGATTCGGACCCCGCGTGACGAAGTCGCTTTCGCTGGTGTTGTTGATTAGTGGCGCTTTGCTCATGGGCAATGCTC
ACTACAGGTGCTTTTGCTCGTTGGTTGGGATCTCTCCACGACTGCACTTTTGACAATGTTTACATTGTTGGTTTTCTTATCAGAGTGAACGCTGGAGGAC
ACGATTTGTTGCTTTACGGAATGGTGCTTGTCGGGTTCTCGGGTCCGGGCATCCAGCTCTCTGGTATTCATATGTCCAACTTGTTCCCCGAGGCAACGGC
GCTGGTTGCGTGCTTCATCGTCGGAGGTCTTCAGCTGAGCTTCTTGATTTTCACGCTGTTCGACCTCGCATACGAGCACCTCGGGTTGTCCATGTCCACG
GTCTTTACGATGTACGCTTGCGTCCTGTTCCTCTCGCTCATCGGCACACTACTGACGGAGCCGGACACGCCGTTCGAGGTCGTTCCCAGTGAAGAGCACG
AGCTCCTCTCGCCCATGCGTCTGCCTTCCGTGTTCAAGGAGGAGGAAGCCTCGCTGCTGATGTCTACACCTGAGTTAGAGAAGTACCGGAGACGCCATCG
TCGACCAACTGACGAGGTTTTCTTCGATGGGGATCTTCACAATCGCTCATTCAGGACGCAGGTGCTGTCCAAGCCGTTCCTGCTTATCGCGTTCTACTTC
TCTATCCTCTCGCTTTGGTGCAACTTCTTCATTGGCAGCATTACAGGCCTGCTGCGGTGGAAAGGTCTCCCTGAGAGCGTGGTGGCCAACTTGCTTGGAA
AGCTGGCGTTCGTGCTGCCGGGCAGCGTGATGTTCATCCCTTTCGTGGGATACCTACTGGAGAAGTGCGGGTACACGTACTCGTCGTTGGTGTGCACGGC
GGTGGCGCTGTGCTTCACGGTCATGTTAAGCAGCATGTCCACCGGGTGGATCGTGGCTGGCTTCGTGGCGTACGCGTTCTTCCGGACCATCATGTTCCCG
CTGCTGTTCGCGTACCTGGGCCACCGCTTCGGCTTCCAGCACTACGGGGCGCTGTCGGGCATTGCGTTCTGCATCGGCGGCGTCGTGGGGCTGTTGCAAA
CGCCCATTGCTGCCATCGGCGACTTCCAGACCATCGGTTATGTGCAGGTGAGTGCGTGGTTTGCTTCTGATTCTGGTCCGAGAGGATCGGCATTGGTGGA
TCCATCTTCTGACTGTTGTGCTGTGGGTGTTCGTTCGTCTACTGCTTGCATCGGACCCCGTTATAATAGTTGGGACACTGCTGCTGACCTTCGTGGCGCC
CTACTTTGAGCGTCAGCGTGACGGGTACTACTAGCGCAATGGGGCGTGTGTTCTGTGCCTCTCCAAGCGCGACAGGCGCAATGCGAAACAGACCGGAAAA
CCAACGCACTCGCCGACATCGGTCGATGCAAGTCCATTGCCCGCTGACTCGAATGCGCCATGACTTCCTCGCGCGTGTTGCCGTCGAGTTGCCGTGCTTG
GTGGCCGATCATGTCGCGCGCACAACCAAGCGAAAGTAATTGAGCTCAACCTTCCGTGTTGTGGCTTTCGGACCAGGAATTAGTATTATACAGATGGTGC
CGAGTGTGAAGACTTCGTTTCTGCTGTTGTTTGTAGAGAATATTGCTGCTATTCTTGTGATTTTCGGACAGCCGTTTTTGGAGGTACCTACCCCGAGGAG
CTGATCTTCCCCAGATGGCTGCACAGCTGAAACCATCGCAAGAAAAACACGCAGCCTTCCCCACCCTATAATATTAAGTTTACATATGAATCGATTCACT
TATGTTCCCGTCACCCCCAATTTGTGTCCTAGTCTACATACATAAATTTAATTATCAATTCATATCGTTATGTGAGGGTTGTGAAACAGCTGTATCATTC
TTCGCAGACTTCAAATGTACCATTCCCTGGGTACAACTCAGTTTGCGGGGCGCCTTCCCCACTCATTAGCCATTTCGCCGAGCTGTGACGACTCCTCTCT
CGCTCGATGTCGCTCTTCTCGCTCCCCAGCGTCCTACGCCGCAGCGTGCCGTCCGACGGCAGCGACAGCGCGCCGGCCGTGCGTCCATCCGTCATCAGCA
CCAGCCACCTGAATGCGCAGCTCCTCGAGGAGGCCAAGCACGCGGACCAGCACTTGTTCTTCGGGCCGCAGCAATCGGTGTTCGACGGTGAGCGCCAGCG
TGTGATCCACGGCGAGCGCAAGATCCAGAAGAACACCAAGCGGTTCTGGCTCATGTCCGAGCCGCTCAGCATGGACCGTGACAGTACCACGTCGCTCATT
GGCTTCCCCACGGAGCAGACGCGCGCCGGTGGAATCGGCAGCAAAGTGACGGCGGCCACGCGCTTCCTGGGTCAGAAGGTGGCGCAGATGAAGTTCCCGG
CCTCGCACGTGAACGAGGACTCGTTCTGCGACGGCTGTGGCATGGACCCCATCGTGGGCAACATGTACTCGTGCTCCAAGTGTGTCAACTACCACCTGTG
CGAAGGCTGCTACCAGCTGGGTATTCACGGCTTTGAAGAGTCCAAGTTGCTGCTCGACGTGCGCGAGGACTTTGCCCTGCGTAAGGTCATGGACGTATGC
AAGAACAAGGTGCCCGAGGAAGTCTTCACGGTGCTGCTTAAGACGGTGTGTCGCGGACAGGTGGACAAGTTCAACTTCCTGGCCAAGTGGATCACGGCCG
TCGTGCTCGGCCAGCCCGTCAACTCGCTCGAGGTGCGCGGCATCGAGATTCCGCACCTCGACTCGGAGACGCGCGCGACGCTCGTGCAGCTGCTCACCCC
CGTGCTCGCGGACCGCACGGACCTCGAGGTGTGCATGGAATGGTTCTGTCCGGTAGGTTTTCTTGTTCTTGAAGCGTTCGGCGAAGATGGGACTGATTTT
TTATTGCTGGCTTCTTGATGATGAATTAGGACGCTGATAAGATGGACCTGCCCGGTGTACAGCGCCGCATGGAGACCATCCGGATCTGGGTGGCCACCGA
CAAGGACCAGAAGTCGCCCTTCGCTACCAAGGATGGCCTCAAGGACGAAGACACCGAGTCGGACATGTCCCCGACTAGTGGCAATGGAGATGTTATGGAC
TCGCCTGGCCCCGCCAGCCCCGTTTCGAGCGTCAAAGAACCGGAGTCGCCGGGCGCTACGCCGCCTCCGTCGCCCAGCGCAATCCGCCGCAAATCCACGG
GAGCGACATCCATGACGTCCGAGTCATCGTCGCAGGCCTCTCCTCCGCGTCTCGGTGCACTTTCACTGGCTGACAAGACTGCCGAATACAGTTACGAGGA
CGAGGACGAGGACTACATGTCCGACTCGGTTAAGAGCGACATTGAGCCCCGGAAAGTGGACAGTTTGTCGCCCTCCTCCGGTCACCGATCGGAAGGCATT
GAGATGTAAAAAGAGCGAGGGGAGGAGCGAGGAGCGGACAAGATGCGACTGTGAATGGGCTGCTACTCAGTGCAAGCCGTAGACACAGCGGGTCAAGTGC
GCGTTCTTGGTCTTCCTTCATTTTGTTATTTTCATTTTCGCTTTGCTTTCACCAAATGTAAGAAGGGGTTGCTAGGATATATAAAAAATCATCTTCATCC
ACTGCGTTCACGTTCAATGAAGCTGGTATAAGAAACAACAGATTCGAGAAGTGTCGATTAACCTTTCTTCTTCTTCTTCGTGAAGACGGCAAGTACAGTA
CCCGTATCTCGTGTCTACTCGGCTACGTGCTCGCACGAAACCATTTGCACAACGGATATTTCACTCGTCGGCAATTTGTCGTGCGCTCTTTTATCATACC
CACGCGCTCGCATCCTAGTTCTTGGCACGGTAGAAGGTAAGGTAAGCCATGTGCCAGTCACCCCCGCCCTTGAGCTTCATGATGTCCTCTGTCTTGCACG
GCGACACATCGTCATCATCGTAGCAATACCAGTCGTCTATCATTGCACAAAACACGTTATCAGCTTCTTCGTCACCTGACGCGTATGATGAATAAACCAC
CGTGTGCTCACCTCCTTCATGGCGCACCCAAGCCATATAGTGACCAGAATCGGCCGAACGACCCTTGTGCGTCAGAATAGCGAACAGCTCGTAGTTTCCC
TATGTCAAGCACAACACGAACGTAAGCATAAACCATCCAACCACATACACAAAGCACACTAGGCATCAAATACGTACTTGGAAGTCAATAGGAAGGTCAA
TACCAGGAGACTTGGCTCCCATCGAAAGCGCGCGAGCAGTCTCGAGAGCCGCTCTGTCCTCCTCGGACAGCCCGTCCATAGCGTCATCCTCATCAGCCTC
TTCCTTCGTCTCTTCGACGTCCTCCTTCTTCTCACCTGCAGGTTTCTGCTAAGTGAAAGCGGTACATCAAGCAAGAACGTAATGAGCGTGAGTTCTCCTT
TCTCAATTACACCGCACTGTGATACCGCGTACGTACGTCCTTGAACTCGTTCAAAATCTTTCGGCATTCCTGTCACGGGAGATCTTCATGGTTGCCTGTA
GCTCGTCAGAGCAGAAGTCGAAGACATCCAGTGTCGTGGGGAAACTGATAGGCTGCAGAACCAAACGTGTTCCGTCAATGGACGTGCCTAACAAGCGCAA
GGAAATACTTTCTTTACCCGCAGCATTTTGCACTTGACACCGGTGTGGTCGCGGCTCTCCGGCGTCGCCTTCCAGTAGAAGCGCATAAACTGTACGCACA
GTACTTGGGCAGGCGTTTATCCGAAGCGTTTTCTTCCACACTGCGTTGCGATCCAGCACATCCGAGTGCTTCTCAATCGTTCCTTCCAGTCCCTATTCAC
CAATCACATCTTCAATAAGACACCCAATCTCCATCCCAACCCAAATCAAAGCAACAATCATAAAACTTACAATCTTGATGCCTTCGGACAGGTGGTTGGT
CTCAATGGTGATGTTGCACACGAGCTTGAGCGCCTTCTCCTTCTTCAAGACGGGGGTCTCCATCTCGCTCTCCGTGCACTCAATTTTCTCATTCAACTCC
AACCCAAACAACGCGTCCACGACGTTGCTCGTGGGTCCGAGAGTCTTTAGTGCCCCCGCGGGTTGCGTCAGCGTCTGCTGCAGCGTCGCAAAGAGCGTGG
ACAGGAACTCCTCGCTGTCCTGCTGCATGTACCCGCCACTCCTGGGCGACTGCTGCGCGAACTGCGGGTACGCGCGACGCAGCACGGACACGAACATGGA
GGGGGTGATGCTGTCCACGCTGCCATCCAGCTGTGTGTACATGTCCTTGAGTGCAGTAGTAAAGTTGTTGGCCAGGTCAGCAGACACGCCACCCGCCTGG
GCCTTGAAAGCCTCGCGCAGCTCCTTCACGGGCCGCAAACACTGGAGCGTGGCGTTCATGTAGCACGTATTGCCGAGGTTCACGAGGCCTGCGGGATACA
CTGTGCCAGTAGCTGCGATATCCTTGGTGGTCATGTCCTCAATGAAGATAATGGGCTCCTTGGGCTTGTTCACCACCTCGGCCGATCCCATGAGCATGAC
ACCCGTGCCATCCACGAGCTTGTCGAGCGTCGAGAGGTCCACGTCGTCCTTGAGCATCCCCTTCCAGGCCTTGGACATGAGCTTCTGGCGCTCCACAGGC
ACGGACGTGAGCGCGTACAGCTGCGCCTTGAGCACGGCCACGGGAGCTGACTTGTCCACCGCCACGTCCTTGAACACCTGCTTTCCCCATTTGACACTCA
CCTGGGCCGTCATGACTAGCGTTGATCCTTGGAGCTCTTGTTGGACTGTGGGGGGATTGAAGATCGCGACCTCGAGAAGCTTCATTTGATTGGCAGAAAA
CATATTATACGGCTGATGATTGGTGGAATGTGATTACGAAATCAATGTCGAATTTTGGAAATTGGATTCGTAGAGATTCGCACATGGCTACATGCATGCA
CTGCTTATAGATCTTAGGATACTTTCTTCTTCGCTTAACGTTTTGGCACCTCTCATCCCGCTCGGTACTTGGATGTCGTCAAGGCGACCGTATCACGCAG
AATGGCGTCGCCCGTCGCCTGGTCTTCGAACCACTGCATGCTCGCGTGAGTGCGGTTGGCCACATTCAGTAGCGAGAAGCCGTAGTCAGCTTGGCGGAAG
GCTGACCACTCCGGCTGCGGGTCGAAATACGTCGGTGCCAGGCCTTCGCGGTTGCCGGCATCGCCTAGCACAACGTACACGGGGGCGTCTTCAACGACCT
TCTGCTTGTACACTGGGTGACTGCGCTCGTAAGCGTGGACGTGTCCGGAGACGACGACATCCACCTTGTTCCGGTAGAGAATATCCTCCATGTTCTTCTT
CATGATCATGTGTGGCTCCATGCCCTGGTGCGCCGTGTTGCTGTTGTACCACGGCCCGTGCATGATTACCACCAACCACGGGGTGACGCTGCGGTCGACG
CGCTGGAACTCTTGCTGCACCCACTCGTACTGCAGCGAATCGGGAGTCGAGTCGACGTACGGCGTCAAGATGACGAAGTGCACCAGGCCCACGCGGAAGC
CGTAGTACAGGTTGCGACGCTGCAGCTGGTCCGTCCGCTCGTACGGCATACGGAATCGCGTCTGGTACGCGACGAACTCGCTCACTTCGCGCTGACAAGG
CCGCTCCATCTCGTGATTGCCCGCTGAGATCATCCACGGCATCCGGGCAATCAGCGGCTCGACGAGCTTGCCCCACCGATCCCAGCGGTACTGCTCACTG
TCGGCGTACGACAGATCGCCAGCACACACGATCATACTCATCTTCGACTGGAGGCCAGCGAGGTGGCGAATTGTCTCCTCCGAGTACTCAGTTTGACTAG
AGTAAAGAAACAGATCGATTAGAATCAAGAGCGTTATCCTCAGCATGCATTGTAACACAGTAGCTTACCCGAGGTCACCAATCACGCCGAACGTCTGTGG
GGCCTCACTGCCGACAGGTACAGCCGTCTTGAATGAGTACACAGGACTCCACCCACCCGTTTCATCACCGCACTGGTCTGTACAACACACACACAGTCAG
CCTTTCAGTCTGACACAACGTACACCACTACTACATACAGTAGTAAGTCGTGTCCGCAACCAACTTGTCGCCGGGGATCGTCACATGGTGTAGCCACGGC
GACGTGTACGTGCAGAAGTCGTACTGCTCGCACGGTTCCTCGGCCTGCTGCACGGTCGAAAGGGCGTCCTTGTCTAGTCCGTAGCGCACCGTGGACTTAG
TCGTCTTGACTTCCGTCGCCCAGGAGACGGTCATGCCCAGCCTCAGCTCCGAGGCTGCAGCGTTTGCATTGCGGATGGCTGCGTAGCTCTTCACGGCCAT
TTCACCGGCCAAGGCGACGTGGATCTGAGCCGGCGGTGCAGCGTTTGAGGGCACCGCGAGCATTGAAGTGGCGTGGCTCAGACTCTCGTCGTACACCGGC
ACGCGGAACATGTTGACTAGCACAAAGGCTGAGGTGAAGAGCAGCACAGCGATGCCGAGGATCGCCATCCTGGAGTGTGTCGAAGATGGTTTTATTTCGA
GAAGAGGCGCGCTCGAGTTCTTCCGCCCGGCGTTGGTGGTGCGAGTGTTCGCAGAATTGACTCGTGGGCGAATCGTCGAGCCGTACGAGACTACAGCCAC
AGGGTCGGGGACAACAGCCAGAGTGGCTTCATCCTTGTGTCAATACGAATGGAAAATGAGGGATGCCTTGCCCATGAGAGCCGAGGTGCAGGCAGATTCA
GAGCGCTGGCATCCTGGCACCGGAGAGAATCTTCGTCCTCCGTGAGAACCGGCCGCGATGCTGTTTGTATTTGCAGAGCACCAGATGGGATCGTCCTCCA
AAGTGAATCGGGCTTACCAAAAATCTCTTGTGACGTGTACGAACGCAACATAAGATTGGACCAAGACACCTTGAACACTTCAGCTCCACACGGCCCGCCC
AAATACTGCAAGTGACGCATGACCAAGAAGTGACGAACCTCTCG