Description :
From Genome Similarity Track
Location :
Scaffold_86:6079- 8679
Sequence
2600 bases(100 bases per row)
GATGCCGGAAGTATCCTCGACGGAGGTGCTCCAGCATGTCTTGGCATCTGCCGAAGAGATAATTAATCTCTCGGAGATGACGTGGGATCTGTTCCTGTCC
GAGCTAAAGGAAGGAAAGATCCACGAGATAGTCGCACCAGTTCCATAGGAGAACTCGGTGGACTGTCGCCCTTCGTCCACAATACACGAGAGTGTCTTGG
ATACCGACAAGACAAAACGATTCGCTGCTCAAGGCTGGGACGCCTTGAAAAGTAGTCCGTTTTACGAAGTTCTGTGGAAGCACCGTGGTGTCTTTCCTAT
AGAAGTGCCGAACCACCAACCAGCCGATAGGGGTATCCATCACGAGATTTACTTGGAGCCTGGCACCAAGTATTGTGTGACCAGGCAATGGCCTTTGCCG
AAAGAACAGGTCGATTACTACGACCAGTTTTTTTTACAAGAGAGCCAAGGCGGGACATGTACGTGAGAGCAAATCGCCTCACTGCAGTCCGACCTTTTGT
GTGCGTAAGGCAACAGGTGGTTGGCGCGTAATTTATGCTTACAATAAGTTGAACACTTCCACCATCCCATCGCAGACACCGATCCCACGGAAAGATATCC
GATTGAACTCAATGGGGAAGTCAAATATATTTTCCGCGTTGGATTTAAAGGATGGCTACTATCAGGTACTCACTCATGAATGAGACCGATGTAGCTAAGA
CGGCAGTTAGTACCTCAAGCGGTATGCTGTGGGGGTGGCTAGTGATGCCGCAAGGGTTAAAAAACGCACCAGCGACATTCAGCCGGGTGGTCGCTCATGT
GATGCGCCCACATCGTGCCTACGCGCCATATTACTTTGACGATGTATTCGTTCATAGTAGGTCCGAGGACGGATTGAGTGAGATAGAACCGCACAAACGT
CATTTGGACGTTGTGTTGCAGACTCTGGGTGACACCCGATTGTACTTCAACTTGCAAAAGTGCGTCATAGGGGTCCCCGAAATACCTGTACTGGGCTGAA
TCGTGGGTAAACACGGTGTTAGAGAAGACCCAGAGAAGGTTAATGCTATTAAGGAATGGCCAGTACCACGAAATGTGAAGGATCTGCGTCAATTCCTTGG
GCTTGATAATTACTTGCACAAATATTGCAAGAATTATGCAGAGCAAACCAAACCAATGTCTGACTTCTTGAAAAAGGAAGCAGAGTGGACTTGGTCTGAG
GATCAAGTAGATGCTTTCACTTCAGTGAAGCAGTCACTTGTAGAGGCTCCAGTCTTAGCTTTTCCAGAAGCGGATAAGCTCTTTAGTGATGTCTGCGATG
GGAGTAATTTCGGTATCGGCAGTGCACTTATGCAAAAGGACGACGACGGTATTGACCGTATCATCTCGTATCAGTTCCGACTACTAAAGCTGCAGAGCTG
AATTAATCCGTGCACGACAAGGAGCTACTTTCTATAAAGTATGCTCTCGTTAAGTTTCGAGTGCACCTATTGGGCACCGAACCTTTTGTAGTTTACATGG
ATCATGCATCATTGCAGACCGCAATAAACTCACTGCACCTATCACCTAGGATGGTGAGGTGGCTTAAATTCTTCTCGGATTTTAATTTTCGAGTTGAATA
CAAGCTGGGGAAGTCAACTATCTTGGCTGACGCGTTATAGCGCAGACCAGACTTCGAGGAACGACACCTTGAAGACGTGTCTCGTGCTAAAGCACGAAGT
GAGTCGCCAACACTGGTAGCCCTGCGGGTTAACCACGTGAAAAACACTCTTACCTCTGATATAAAGGAGAGATACATGCAGGACGACCGTTGTCGTCTGC
TTATAGATCACTTTGGTGGACAAAAAGTTAATCTCCCGTCTCACCTCAAGGCGAAGCTTAAACGCTTTAGTTATAGTGATGGCCCGTTATGCCATCAACA
GTCACCTTGTGATCCATTGAGAATCTATGTCCTCCATGACACAGATCTCAAACAGAAGATTCTCTACAAGATCCATGATGCACCATCGAGTGGTCGTCTG
GGCCACGAAAAGACATTTTTACGAGTGTCAGATGTATTTTGGTGGCCACACCTATATAGGTGGGTAGCCAATTATATTCGATCATACGAAAAGTGTCAGC
GCGTAAAGCTTGCACCTTCTAGTAGTGCTCCATTGAAGCCACTACCGATACCAACTGATTCTTTGAAGTCGGTTAGTTTGGACTTCATGTTTGGCATGCT
GCCTGACCATAAAGGCAGGACTGGTCTCGTCGTCTTTGTTGACAGAAAAATGGTGCATTTAGCACCGTTTAGCACCAAGATCTCAGGCGAGGAGGCAGTT
TTCTTGTTCACGGATCACGCGTATCGGCTACACGGGATGCCCAAGTCTGCAAGCTCTACATGCCTACGGCCGATCATCCCCAAACCGATGGCCAGACCGA
AGGTGCCAATCGTGTTGTGGCGGATGTATTGCGCACAATAGCAGCTCCAAAGGAATGGAGAAAACATTTGCCATTCGTTTAGTTTGCTATTAACAACAGT
GTTCACACCAGTACGGGTGAAACACCATTCTACGTTAACGGACTGCGCCATCCTCGGGAGCCAGTCTCGTTTGTCCGCAGTCCGAGTCTTAGTGGGGGAG