Description :
From Genome Similarity Track
Location :
Scaffold_1:6079- 8568
Sequence
2489 bases(100 bases per row)
GAAACTTGAAAACTTGAGCCCGGCGCTGCTCTTGGCATCACATAAAGGTTCCGTTTCAAGGCGCCCAAAACTTCTAACCCATGAAGCTACACCATTTGAG
CCACTGATCCCAAGAGCGACGATACTGTATGCGAGATGTATCAGGTAAAGCTTTAGCTCGGAGCAGTGCACCCCAAGTTTGGAGAGTTGTCTTAAGCTCG
ATGGTATCTCCACCTGTGTCCACGCAAACGACATGTCAGCAAACGAACGTGCCATTGCTTCCGATTGTCACACCCGGCTCCCTGCATCTGCCATGATGTT
CTCGACTCCGGGAATATGAGCTGCAGACGAGTAAAAGTTGTAGCGTACTTCGAGAAAGCCAATGAGCCGGAGCAGCATTTGAGAAAATGAATTTCGAGAT
GATCGGCGATTTGCCCATGCCACAGCTGAAGTGTTATGGATCCAAAATCGTGTATGAGCCTAATCGTTCTGACCCGACTGCGCCCACTGAGAGACCCACC
CAATTGCCGCAGATACAGCACTCATGAGCTCTCGAATGTTTATGCTGAACTCGTCCGATGTCGACTCGTTGCAATGTGCGATTTGTTGTAGTTCTTCCGC
ATCCAATATCAGTTAAATATATTCTTTTCGAGCTGGCCAGAGCGCACACAAGCCACGGTCACTAGCGTCCATATGAATAGCACCGCATTCAACCGTCCCA
AACAAAGAATTGCTGCGAACCATCTCAGATCGTCGCGTGCTTCTTCAGATATTAACGAAGGACGATAACGAGTGGTTGTCCGAGCTAATGACGCGATCCG
CTGAAAAAATTGAGTAGCCGTACGAACACACGTGGCCACGCGCCGTAGGCTGCCCAGTAATTTATTGAGCTGTGTTTTGGACGCCAGTTGAGCCAATTGA
AGCCCATTTATCCTGTGAAGAGCTTTTGCAATTTTGTCCTCGGGCATCAAAAGAGTCATCACATTAAGGTTCCACTGATTTCGAAGAGTCTTCCCTTCCG
TAAACCACGGCGTGAATTTCTCTTTATTGCACGCGTTCGGGTCAAGAACTGGCGGAGACGAGCATTTCTCTGAGATCGGCGAGATCACCATCGCTGATCT
CAGAGAAATGCTCGCCTCCGCCAACCGGGAGCCGATGTCAGGCTCAATACAAATGTGGCCATCGCACCACGCCTTGCCGTCAAACTTATCGGCGCCGGCT
AAATGCCGGTCTGTCCACAGTGGAGCGGTGTTCTTGTGTAAATGCACGGTCGCTCCACCTGCCGCCCAGTAATGTCTTGGAGCATCTGACCACCCAAACG
GGCACGCCAAATCGATAATTAATATACCGAGCTTTGGAGTTGTCCCGGAAAACCGACCTGCTGATTCTACAGCCACTGGAATATTGCGAAATGCACTTGC
AACGTCTCCAGTGGATATTCGAGCCGCTTCAGGAAGGTTGTGATCCACATCTAGCACCCGCCGAGCCAGTACAGCTGCACCGTCATAGGTAACCAGGATC
TGAGTGCCCTCCTGAGCATGATCATTAACTAAGTCGCCTTTTGGACATGACAGATCGTGGATCATCCTTGCACCCACCGTGATGTCTGCATCTCCTTTAT
GCACTGCCCCAAATGGACTACATGTAACTCCTTCGAGCGAAGGCAGTAAATTAATTTCGATAATCAGGTATCGGTCTTCATCTTGACCTTTCCTCAGGCT
CTTGATAACTGCATTAAGAGCTCGTAATGCAGAGCCATAATTATGTGGAGGCCGGGTTTGGCTTGAAAACGTTGTAGATAATTTTGGCCTAACGAAATGC
GTCACAATGTCGCGCCATTCGTCTTTGTACGTGTATGTTCTCCAACAAGGAATATGATCGAAAACAGTCAGGGTCTTGTTTGGACGTGGATATTGGGAGG
TTTCTCCGCAAACCAATCGAATAAGGTCGAGAGGCCCATTTTCTACCGTCGAAGTAGCGCGCTGTACGCATACTGCTTGGTCCGGTCAATCTGGTATAAC
CTCGCTCCATTCTTCACAACCCAAGCCGGCGAATCCGTTGGTGGAACCACTCCATAGTGCTTCATGATCGAGGCGAGACCATCTCGCGCGCGGTGGCGCT
GAAGGCCTAACATTCTCTCACTTGCTAGGAGCGTCAGCGTGTAGCGGCGCTGTTGACCCGTCAGGAATATTTGAAGTTCCCCTGACACGACAGTCCGCAT
CTCATGTCCACGCTCCTTTCTGCCCACGCCGTGGCAACGAGATTCATTAGACCCCTGAACCGACTTGCAATTACTTTGCAACGGTACAACATCCCGCCCT
TTGGGGATTAAATCCTCGTTGGGCCAACCGACCGACCTGCAATTCTTATGCAGCGGCAAAACAACGCCCAAAGCGTGAGCCTGAGTCACGTAGGGCCGAC
TCACCTGACTGCACCCCTGATGCAGCGACAGACCAGAGCCAACTTCGTGAGCTTGCGTCCCGTTGAGCCCCTCGACATGGATGCAATTG