Description :
From Genome Similarity Track
Location :
Scaffold_625:6079- 8212
Sequence
2133 bases(100 bases per row)
ACGATCCACCCTCGGTTCTACCTCCAGATAGAGGTGTCCGTCATGAAATTGACTTAGTTCCTGGGACTAAATGCTATGTCACACGACAGTAGCCCTTGAC
TAAGGAGAAATGTGATGTCATTGATGACTTCTTCCGTGCTAAGCACGAGGCAGGAATGGTTCGTGAGAGTAAATCTCCACATTCGACACTGACATTTTGT
GTCAAAAAGCCTAACGGCAAGTGGCGTATTGAGCATGCTTATAACAAGCTTAATGAGGCTAATATTCCGGCATTGACACCCATTCCTCGAAAGGATGTTC
TTCAAAACAACATGGTTGGTTGTACTATGTATAGCGCACTCGACTTGGCTGATGGATATTATCAATTGCTCATGCGAGTGAGTGACATTCCGCTTGCAGC
AGTGAGCACTCCGAGTGTTATGCGATGGGAATGGCTAGTGATGCCCCAAAGAGCTGTATAATGCTCTGGCAACATTTAATCGTCTGGCGACGCAAGTTTT
CCGCCCATATCGGGATTACGCACGGACTTTGATGACATTTTTGTCAATGTTCGTGCCGAAAAAGGTCGGTCAGATGTTGAAAATCATATCGGTCATTTGC
GAGCCGTGCTCGAGTACATGCGCACTAATAAACTGTACGCCAACGCGTCTAAATGTATTTTTGGTTCAGGGGATATTCCTTTCTAGGATGTTTCATTGGT
AAGCGCGGCCTTCGAGCGGGTCCCGCTTAGGTCAAAGCCATAGACTGGATGATTCATAAGAATCAAAAGGACTTGCGTAAGTGGCTTGGCCTTGCCAATT
ACTTACACAGATACAGTGAAAATTACGCTGATATGGCCCAGCCATTAAATGATCTCGTTAAGAGGGACACCGATTGGCGCTAGGACAACACCCTTGCCGA
CGCATTTCGGGCAATAAAGGAGAGTCTCCTCCATGCTCCCATTTTGGCGTTGCCAAATCCTGAGTACCCTTTCAGTGTTGTCTGCAATACATCCGACTTT
GCCATTGGCAGCGCTCTAATACAAACAGATGCTGCAGGCCGCTCTCTAGTTATCGCCATTGAATCACGTCAGCTGAAAGCTGCTGAAAAGAACCATCCAG
TTCATGACAAAGAGCTACTTGCTATGAAGTATGCGCTCGTCAAATTTAGAGTCCATCTACTTGGATCCAAGCCATTCGTCGTCTATACGTATCATGCATC
ATTACGCACGGCGACACAGTCGCCTCACCTCTTTCATAGAATGGCTCGGTGGCTTTCCTTCTTTGCGGAATATAACTTCGAGGTGAAGTATAATCCAGGC
AACAAAATGTGTTGGCAGATGCTCGCTCTCTCCGACTTGATTGTGAGCTTGCTCATGCCACGACTTTGTCGTCTCCTATTGAGGAACTAATTCGTGTGGA
CTATTCAGGGGTCCTCAATATGTGGCATTGTTTCATGCCCTTGGGAGTGAGGAATACAAGGACTCTGACAGTCAATTATCGGCACGCTTGCAGGCCAGCC
TGCATCGATATTCCATCGATGATGGCCTCTTCTGCTATCGCACAGATGTAGCGGATACCGCTCGCATTGTTGTGCCTCACAATGAGGATTTAAAGAACCG
AATTCTCTTTGAGGCCCACGATACGGCCCGCAGGGGGAATTTGGGCCGGGAAAAGACTTATGGCTCTGTGAGTCGACACGACTGGTGGCCCAAAATCTAC
AAATGGGTGAGCACATACTTGCGTGCACGCGAAACGTGCCAGCGGGTCAAACCCTCAGAACATTCGGCTGCGCCTCTCGCCAGTTTACCTGTGCCCACGG
GGTGTTGGGAGTCCATCAGTATGGATTTTTTGTTTGGTCTTCCCAAAGACTGTGACGGCAATACGGGAATTGTGGTCTTTTTTGACCGTTTAAGCAAAAT
GGCTTACTTAGCGGCGGTGCCGGATTCCATCGATGGCAAAGGTACAGCTATGCTGTTTATCGATCGTGTGTTTCGTTAACGCGGGTCGCCGCTAGCAATC
ATCTCTGATCGCGACCCTCGCTTCACAGGCAAGTTTTGGACTTCTATCTTCAAGTTACTTGGTACGCGATTGATCTTCAGTACTTGGTACGCCGATTGAA
CATGTCCACAGCGGATCATCCGCAGACGGATGG