Description :
From Genome Similarity Track
Location :
Scaffold_126:60786- 61882
Sequence
1096 bases(100 bases per row)
AGCATGGATGCCCCGGAGGCTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTTGAGGACGCAGCTT
GGCTGATCCTCGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAAAGAGGTCCCGCGTCGGGGATACTATGAG
ATCCAGGTCTAGCTCGAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCCACCAACTTG
TTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGGATCTTCGATCTGTCGTGGATTCAGGCTCTGCATGACAGGATCTTGATGCAGGAAGTCGCGTA
AAGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATCTTCTTCCG
CGTAGTCTTACTCGTTTTCGTCTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAATCTGCAAATGCATAC
CGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGTGCTCCCTGAGGGGACCTGGGGAGGATAGAGAGGTTTCT
CTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGCTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGCGTCTTCGT
CGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCAAGTCACCAAAAGATCCGGGC
ACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGGGGTCCCC
CGATGATCCGGGTTCTGGCTGAACTTTTCTTCACCTTAGGTAACCCGTCGGGAGGGCGGGATCCTGCCTCTCCCCGGTACCTTCCGAAGAAGTTCA