Description :
From Genome Similarity Track
Location :
Scaffold_14:60777- 75034
Transcript NameFunction/comments
Physo_258824polygalacturonase
Physo_533643predicted protein

Sequence
14257 bases(100 bases per row)
CGTTTCTTTGGTGTGTAGTCAAGCGCTCGGATTTGTGTAGCCTAGCGTATGCGAAGCCCAGACAGCGCAGCCGCATTCGATGCGGAAGGGTCGATTCGAC
CGTCATGTTGCAGTTATCGCGCTGTTCCGGCATCGATTATTAGAGTCGTGTATCGTGATGCGGCGGTACTTTCAAAAAGTAATCGGGTGGAGACAAGAGC
CCCCAGCACACGACCGAAAGTTGACTGGACGCAACAGTCGCAATAGAAAGGGAGGATGAGCACTAAAACACGTAACAACTTCAAACGCGTTCAGGCGCTG
TGAACTCGCCCCATACCTCGCAGAACTGAATGCCATCATAGCCGGCGGTTTGTTTTCCAGGGCAATGCAAGGTTTTGTTTTTGGTACAACTCACAGCAAC
GTGAAGCTCCCAAATCTGAAGGAGGTGCGCCATCAACTCGCAAATTGTCTTGTTTACTAGTTCCGGACCACGATATTACATTCCGAGTATGTGTCATCGC
GTAACAAAACTTCAGCTACCTGAGTTTGTTGGAACAGATACACCAATACCCTTACGCCGTCTTTGGTTTGGAAGGCAAAATGCTAGTATTTTGATACAAA
GAGAGCGTGCAACCGGGTTTGCCAAATTAGAAAGGCTGGCCCCGGCTTGTTTGACTACGTTTGGAGATGGAGGGCAGCTGCAGCTATGGTCACTTGCACG
CCGTTTCGTGGCACGCCAATGGTGTCTGCACGGCATGCTTCCGTAGAAATGGAATTTGCTTCCGGCTGCGTCGCCTGTCGTGGTCGTCTTGATCGATGGC
AGAGGGAGTTGACGATGCTCTAGGGCCTGCTCCGCAACACCGCTGTTTGAAAACAGTAGAATGGTCTTTCCGCTGAAAAGAGGCAATCCGCAGTTTTGAG
GATTCCGCTGGAAGCGTTTGCGGAACACACGGATTTCAATGCGCCAGACGCTAAATGGTACTGCAGAACATTGTTGCTGGTGCAGTTATAAGCGAAGCAA
GTGGATAAATGTTTGAAAGAGGAGCTGCCGCGGGGGCGCTCGTTTGTTCCCGGACCACCCCAACATTTTGTCGTGGCAACGACGGCATAACCCAGCTCGT
GGCCTCCTGTGGCGCGCTGGCAAAGTTGACGCTCCTTTAGTAGGGTAACGAGGCGCCGCCAAGGAGGTCCAGGTCACGTCGGCCGCAGCAGCCCTTGATG
ACCCCTTCCGTAGGCTAGCACCTCCGTACATTGCTAAGCTTCTTCTTCACCGTTGCCACCTCCGACTGAGTCGGCGACTCAACTGGGTCGATATGTCTAC
GCTGGCGTTGGCAGAGCAGTACTTGGCCAGGACTTTAACTACTGCGAGGTGACCCACCAGCGCACAGCAGACGCGAAGGCGCGGCGTCGGTTGCCCATCG
CGACATTCGCATCCAGCCCCGCGGCGTAGAGTAGCGCCGACGCTGTGCAGCCTTCGTGGCGGTTTGCGTGTAGCCACCGACTGGGGCACCTCGCCACACT
ACAGAGCGGTCTCCCGCACTGACGGCGCTGCCACCTCAAACTAAGCGCCACCGCGCTGTTGGTCTCGACCGGTGCGCTTATGCCACGGTAGTGAACAAAA
GCTCGAGCGAGCAATATGTGCTATTACAGGCACCAGGGGCTCAATCCGCTAGATCCCCCCCCCCCCCCCTACGCCCAAATTCGGGCGTTTAGCGGGTTTG
GCGAATGCCGATCGCAAAAAGGTCAAACAGTAGTCATCCAACAAGTTACGCCAGCTCTATTATAGCTGGGCTCTTAAGCTAGTAACATATGTTTTGAAGT
CTGGTGTGGTTTATCAAGTATCCTTCATTAACGTAGCGTTTGCCTGACATTAACTTCAACTTCGTGCACACATTTTCCAGTACATAGGTAGTACCTAACT
TGGAATCTATAAAACACTTCTTTAAGTGTATTAAAATACACAACAACACAGTCGATGATCTTACACACGAAAAGTGTTCAGGTGCGCATGCTCGAACAAC
GTGTTCGAATCAATCGGCACACCCCTCAGATGCGCGACCATGTGTGTGGCTGTTTCCGGAAAGAGTACCCATTAACAAGGAGCAGATACACCAGCAGCGT
GGCAAAAGCTTGGTAGTCAAACGATACGTAGATTTACTTAACAATAAAACATGGGTAACGCTACGGGTTTGCGCGGATCAAGCGCAGCGAGTGCACATAC
GGCCTTGATCACGCGAAACAGTCAATAACACGGTACATCGATCTTCTTCAGACTGGAGGCGGCTGGTGGCCCACCAGTGGTGGGTCGGTCGATCGATTGA
TCGATCGATCGATCGATCGACCGGTTGGTGGGTGTGCCGACGCAACTTACTCCGAGCGCAGCTTGCGGTACTGGGTCGCCGCACCAGCATTCGCCCTGGC
GCTTGCGCTCGCACTCGCGGAGGCGCCAGCACCAGCGTTTGCTGCACCAGCAGCACCAGCGTTGCCCACGGCGCCGCCATTGTAGCCATTGTAGACGCCA
ACGTTGTTGTAGCCATTGTAGCCGACGCCCACGCCACCCACACCGACGCCTACACCGCCGAGCCCGACGCCCACACCACCGACGCCGACGCCAACGCCAC
CCAGGCCCACACCAACGCCGTGTCCGTAGTATCCGGCAGGGTAGCCGTAGAGGCCAACGCCGAGATGTCCAAACGTCTGGGCAGCTTGTTGCTCCGCGTG
CACGCCGCTCGAGAGTGCCGCGACGGCGAGGCACAGGACGGCGATCTTGTTGTTGTTGCCGATCATGGTGTTACGTTGAGTGATGTTGGTTGGGTAGTTG
ATAGGAAGACGTTGTGGTGCTCGATTTAACGAGAGAAAGAGAGAGCAGAGAGGATGGTCTCTTGTGGCTTGGTAGTTGACTCGAGAGAGAAGAACGAGGA
ATGAGCTCGGAGGAGCAGGCAGGCCGACAGCCTCTTGCGCGTGCTACATTGGCTCCGCTACGCTGCAATATCGAAAGCCGGTCACAAGGCATTGCAATCA
CAGCAGCCTGCGCTCGTGTGAGGGTCATGATGACCACCACCACCACCATCAAAAACAGCAGCAGGCAGCACCCTTCATTCGAGCAGGTGTAGATCTTCCA
AAGCTTGAAGTGGGCTCGACTCGAGGTGCACTCGACTTGAGGTGCGGAGGCCCAGATGGATACGCATCTATCTATCTTCTTTCGCGCAAGGCTCGAGGCG
ATGAATTCATGTGTGTTGACCATATATATCGAGAACGAGCCGCCAGGCCAGATGGCTGGCGGCAAACTAGTATTGCATTGCGCTGCTGCGACGGCGGCTG
AGACCGTTCACACATACACAGTCAAGAGGCCAGGCTACTCCAGCAGCAGTGCGGGCGTGCCTCCTTATTGTGAGCGAGGCAAGTACGCTCGCTGAAGTTG
CTCGGCCCTCGACTTTTCATGCATTGATTGCCGGCCAATCGTCGTGCAGACTTCAACTTCAACTTCGTCCATACATTCTCCAGTATTGTTTGGGTGTGAG
ACGGGTCGGGCAGCATTGCTGTTGGTTTGGCAGCAGACTACATGTATACATGATCCCTATAGTGCTGTTGCGCTCGTTGTTGAGGATGCCTGCAACCACC
ATAATTGCACTGTGTTGCGGGTTGGCCGCTGCGCCGGGCCCAGCTCATTACCAGGCGGTTAATCGCAGCCACCAACTGGATCGGCACGCCATATGAAGCT
CTGAACGTCATGACCGACGGATCTTGCAGACGCACGATGCTCGCCGCGCGTACGCGCTTGGGCGCACCATGATAAGGCTCCTTAGTGACCCATGGCCGAA
AGGCGTCTTCAACCGACCGGCTCCGCTCGTTATATGTGCGCGCGCGTAAGTGGAGCGGGGTCTGCCACCTCCCAGCAATCGCATACGCGTTGACACACAC
GAGCCGAATGACAAACGCTTGGTAGTCAAACGATACGTAGATTTACTTAACAATAAAACATGGGTAACGCTACGGGTTTGCGCGGATCAAGCGCAGCGAG
TGCACATACGGCCTTGATCACGCGAAACAGTCAATAACACGGTACATCGATCTTCTTCAGACTGGAGGCGGCTGGTGGCCCACCAGTGGTGGGTCGGCCG
ATCGATTGATCGATCGATCGATCGATCGACCGGTTGGTGGGTGTGCCGACGCAACTTACTCCGAGCGCAGCTTGCGGTACTGGGTCGCCGCACCAGCATT
CGCCCTGGCGCTTGCGCTCGCACTCGCGGAGGCGCCAGCACCAGCGTTCGCTGCACCAGCAGCACCAGCGTTGCCCACGGCGCCGCCATTGTAGCCATTG
TAGACGCCAACGTTGTTGTAGCCATTGTAGCCATTGTAGCCGACGCCCACGCCACCCACACCGACGCCTACACCGCCGAGCCCGACGCCCACACCACCGA
CGCCGACGCCAACGCCACCCAGGCCCACACCAACGCCGTGTCCGTAGTATCCGGCAGGGTAGCCGTAGAGGCCAACGCCGAGATGTCCAAACGTCTGGGC
AGCTTGTTGCTCCGCGTGCACGCCGCTCGAGAGTGCCGCGACGGCGAGGCACAGGACGGCGATCTTGTTGTTGTTGCCGATCATGGTGTTACGTTGAGTG
ATGTTGGTTGGGTAGTTGATAGGAAGACGTAGTGGAGCTCGATTTAACGAGAGAAAGAGAGAGAGGAGAGGATGGTCTCTTGTGGCTTGGTAGTTGACTC
GAGAGAGAAGAACGAGGAATGAACTCGGAGGAGCAGGCAGGCCGACAGCCTCTTGCGCGTGCTACATTGGCTCCGCTACGCTGCAATATCGAAAGCCGGT
CACAAGGCATTGCAATCACAGCAGCCTGCGCTCGTGTGAGGGTCATGATGACCACCACCACCACCATCAAAAACAGCAGCAGGCAGCACCCTTCATTCGA
GCAGGTGTAGATCTTCCAAAGCTTGAAGTGGGCTCGACTCGAGGTGCACTCGACTTGAGGTGCGGAGGCCCAGATGGATACGCATCTATCTATCTTCTTT
CGCGCAAGGCTCGAGGCGATGAATTCATGTGTGTTGACCATATATATCGAGAACGAGCCGCCAGGCCAGATGGCTGGCGGCAAACTAGTATTGCATTGCG
CTGCTGCGACGGCGGCTGAGACCGTTCACACATACACAGTCAAGAGGCCAGGCTACTCCAGCAGCAGTGCGGGCGTGCCTCCTTATTGTGAGCGAGGCAA
GTACGCTCGCTGAAGTTGCTCGGCCCTCGACTTTTCATGCATTGATTGCCGGCCAATCGTCGTGCAGACTTCAACTTCAACTTCGTCCATACATTCTCCA
GTATTGTTTGGGTGTGAGACGGGTCGGGCAGCATTGCTGTTGGTTTGGCAGCAGACTACATGTATACATGATCTCTATAGTGCTGTTGCGCTCGTTGTTG
AGGATGCCTGCAACCACCATAATTGCACTGTGTTGCGGGTTGGCCGCTGCGCCGGGCCCAGCTCATTACCAGGCGGTTAATCGCAGCCACCAACTGGATC
GGTACGCCATATGAAGCTCTGAACGTCATGACCGACGGATCTCGCAGACGCACGATGCTCGCCGCGCGTACGCGCTTGGGCGCACCATGATAAGGCTCCT
TAGTGACTCATGGCCGAAAGGCGTCTTCAACCGACCGGCTCCGCTCGCTATATGTGAGCGCTGCCACCTCCCAGCAATAGCGTACGCGTTGACACACACG
AGCCGAATGACAAACGCTTGGTAGTCAAACGATACGTAGATTTACTTAACAACAAAACATGGGTAACGCTACGGGTTTGCGCGGATCAAGCGCAGCGAGT
GCACATACGGCCTTGATCACGCGAAACAGTCAATAACACGGTACATCGATCTTCTTCAGACTGGAGGCGGCTGGTGGCCCATCAGTGGGTGGGTCGGTCG
ATCGATTGATCGATCGATCGATCGATCGACCGGTTGGTGGGTGTGCCGACGCAACTTACTCCGAGCGCAGCTTGCGGTACTGGGTCGCCGCACCAGCATT
CGCCCTGGCGCTTGCGCTCGCACTCGCGGAGGCGCCAGCACCAGCGTTCGCTGCACCAGCAGCACCAGCGTTGCCCACNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGCTCGCTGAAGTTGCTCGGC
CCTCGACTTTTCATGCATTGATTGCCGGCCAATCGTCGTGCAGACTTCAACTTCAACTTCGTCCAAACATTCTCCAGTATTGTTTGGGTGTGAGACGGGC
CGGGCAGCATTGTTGTTGGTTTGGCAGCAGACTACATGTATACATGATCTCTATAATGCTGTTGCGCTCGTTGTTGAGGATGCCTGCAACCACCATAATT
GCACTGTGTTGCGGGTTGGCCGCTGCGCCGGGCCCAGCTCATTACCAGGCGGTTAATCGCAGCCACCAACTGGATCGGCACGCCATATGAAGCTCTGAAC
GTCATGACCAACGGATCTCGCAGACGCACGATGCTCGCCGCGCGTACGCGCTTGGGCGCACCATGATAAGGCTCCTTAGTGACTCATGGCCGAAAGGCGT
CTTCAACCGACCGGCTCCGCTCGCTATATGTGAGCGCTGCCACCTCCCAGCAATCGCATACGCGTTGACACACACGAGCCGAATGACAAACGCTTGGTAG
TCAAACGATACGTAGATTTACTTAACAACAAAACATGGGTAACGCTACGGGTTTGCGCGGGTCAAGCGCAGCGAGTGCACATACGGCCTTGATCACGCGA
AACAGTCAATAACACGGTACATCGATCTTCTTCAGACTGGAGGCGGCTGGTGGCCCATCAGTGGTGGGTCGGCCGATCGATTGATCGATCGATCGATCGA
TCGACCGGTTGGTGGGTGTGCCGACGCAACTTACTCCGAGCGCAGCTTGCGGTACTGGGTCGCCGCACCAGCATTCGCCCTGGCGCTTGCGCTCGCACTC
GCGGAGGCGCCAGCACCAGCGTTCGCTGCACCAGCAGCACCAGCGTTGCCCACGGCGCCGCCATTGTAGCCATTGTAGACGCCAACGTTGTTGTAGCCAT
TGTAGCCATTGTAGCCGACGCCCACGCCACCCACACCGACGCCTACACCGCCGAGCCCGACGCCCACACCACCGACGCCGACGCCAACGCCACCCAGGCC
CACACCAACGCCGTGTCCGTAGTATCCGGCAGGGTAGCCGTAGAGGCCAACGCCGAGATGTCCAAACGTCTGGGCAGCTTGTTGCTCCGCGTGCACGCCG
CTCGAGAGTGCCGCGACGGCGAGGCACAGGACGGCGATCTTGTTGTTGTTGCCGATCATGGTGTTACGTTGAGTGATGTTGGTTGGGTAGTTGATAGGAA
GACGTAGTGGAGCTCGATTTAACGAGAGAAAGAGAGAGAGGAGAGGATGGTCTCTTGTGGCTTGGTAGTTGACTCGAGAGAGAAGAACGAGGAATGAACT
CGGAGGAGCAGGCAGGCCGACAGCCTCTTGCGCGTGCTACATTGGCTCCGCTACGCTGCAATATCGAAAGCCGGTCACAAGGCATTGCAATCACAGCAGC
CTGCGCTCGTGTGAGGGTCATGATGACCACCACCACCACCATCAAAAACAGCAGCAGGCAGCACCCTTCATTCGAGCAGGTGTAGATCTTCCAAAGCTTG
AAGTGGGCTCGACTCGAGGTGCACTCGACTTGAGGTGCGGAGGCCCAGATGGATACGCATCTATCTATCTTCTTTCGCGCAAGGCTCGAGGCGATGAATT
CATGTGTGTTGACCATATATATCGAGAACGAGCCGCCAGGCCAGATGGCTGGCGGCGAACTAGTATTGCATTGCGCTGCTGCGACGGCGGCTGAGACCGT
TCACACATACACAGTCAAGAGGCCAGGCTACTCCAGCAGCAGTACGGGCGTGCCTCCTTATTGCGAGCGAGGCAAGTACGCTCGCTGAAGTTGCTCGGCC
CTCGACTTTTCATGCATTGATTGCCGGCCAATCGTCGTGCAGACTTCAACTTCAACTTCGTCCATACATTCTCCAGTATTGTTTGGGTGTGAGACGGGTC
GGGCAGCATTGCTGTTGGTTTGGCAGCAGACTGCACGTATAGATGATCCCTGTAGTGCTGTTGCGCTCGTTGTTGGGGGGGCTTGACCGGTATTGTCGGG
ATTATCGTGGGACCAAAAGCCACCAACTGCCACCAAAAGTCACCAAAAACCACCATGTCCTGACATCTGTCCTGGGACCCCCGACAAATATAACAGCCAA
TAGGAGACAACATTCAGCAATCTCGCCAGAAGCAGCAAGTTGATGCCAACAAGATCAGTAACCGTCACTGCCGTGGAGGCACTGCGGGCCCGCAAGCTCG
GACGGTGCATGAAGTAAGTGCTGCAGATCCTAATGAGATGTATGCGGTGACCTATGTTCTTAACTATTCGATTTGCTTGTGCTGATATGGCAGCATACTT
TAGTGGTGATGTGAAGCCGACTACTGAGCGGGACAGACTTACCACAGCTAGCCGTATCAAGTGGCTGCTCAGAGCTGCTGCGGCCTCTACTCTGACTAGT
GCTATGGCTAACAAGAACAGGGGGCGAGGCCTTGATCGTGCTAGGCATCCTGCATCACTGTTGCACTAGATCTATCCGCGTTGATATGGTTTCGGCGACT
CAGCTGGCGCAAAGCGCAAGCAAGCTCACGGAAGCCAACGTACCGTAGACGATTGAGGCTCACTTCGCCGGCGTTCTTTCAGTTGGGGATCGACTCCAAC
TCGTGCTATGTGAAGGTACATACTCATTTTCAAATGCGTTGTGGGGTGTGCTAATTACTAAGATACTGCTACTTGTTGTATATTGATGTAGACGTTTAGC
TGGTGGCAAGCGGATTTATTCAGCATGAAAAGAAACTGGTAATAGACTGCATTGGTGCTGATTGGCGGTGCATGCAGTTCGGATTGGTGCTGTTGGGTCC
ACATCCACGCTTTCGTTTGTTGCAGCTTGCGCACGCTGGGCCTGTTGGCCGTGCACGTTGAGCGTTTGACTGTGTACAAATGCAGGTGGTACAGGTGCTG
GGTTTGAAGATACACTCCCGGATACCGGTGCTGCTGTTGGCACGCTGTTGCCTTCTGCTGCCTGTAGCACTTCGCGCCGTTTACGCTCTGCATTGAGTCG
ACAACGAAGTTTGTTCAAATCCAAGCTTCCGGACGGGTGCATCTGCTGGTATTTTGCGACGATACTCGGCCACTTTCCGTGAGCCCCTTTTCGAAAACTA
GCCGCGTGCTCCAGCAGAGCATCTAGAGTGGTTTCGTCTAGAATTTCAAACCGACTTCTTTTTGGTGAGTGTGGAGCTTCTTGGCTACTTGAATTACTGG
GGTTGGTCACACACACAGCCATGCCAAATTGTAGCTGCTGTGTAGAAGCATCTACCGGTGCAAGAGGTTTCGGTGGACGAGATACTTTATTGTCTGTGAA
CGGATCTTGCGCGAGTGCCTCTACGGAGGCGTTTGGAGGTTGGATGGAGTTACACGAAGAAGTGTTGAGTTCGACACCTTCATCTCTGCGACGCTTGTAG
CTTACGGACCGGCGCAAAGAATCCCAGCGTCGCTCCAGAAATTCACCACTCTTCTGATTAGTTCCCGAGCATGTGTAGGCGGCAAAATCGTACACGGAGC
GGTAGACTTGCTTGACGTGCTTAATACCGACCGGTAATCGAAGTAGCTGGAACGGTTCTTCCTGCAGAGCCTTTTCTTTCGGCAAATTGGTTTCATCATC
GAGCTTAGTGGATCCTTTCAATACGAGCATGCGAGAGACACTGGATACCACCTTCGCTGAAGGCTGCTTAAGTTGCGAGTCGATTACAACAAGTCTGTGA
GCAATGGCACGGAAGCCTCGTTTCTTAATGTCCAGATTGGGCATCGTTGACCACAACGACCGACCAGAGCCGACACGCTGGCGGTAGATACGACCAGTGC
CTCCACGATACTACCACAGCAGCGCTGAAATAGCGCGAGATCACGCCCGTCGTCCTCGCCAACCGTCCCCACCAGTCTGTCCTCATCCACCGAAGGCTCT
CGCACGCCGTCGCTGTGCTCCAGCCCGATGGAGCCGCAGTACTTTGTCGGTAGGTCGTCGGCAACGCCGGCACGTACAGAATGACATCGCCACTCGCCTC
GGCCTCCGTGCTGCCATCAAACGCGACGCTCGGCCCACTCCACGCTACTCCTCGACGTGGCTTGCCGCCAACATCATTCCGACCAGCACGTCTATGCCGG
CGACATGCCGGTCTCAGCGCACAAAGCGCTTCTTGTTCATATCACTGCGCCAAAAAGCTTGTTGTGAGCGGTGCGTTGCATTCTGTGAACAGAGCTACAC
CGGATGTCGACACCTACACTTATTCATGGTACTGTCGGATCCTCGAATCGACAGCTTGCAGCCAACAACAGTAGCTCACGCTACTGGCGGCCACTCCACC
AGCCCTTGTAGCCAACAACAGTAGCTCACGCTACCGGCGGCTACTCCACGGCAGGCCTGGATGCAGCTTGTCAGCGGCGTGAACGTCCCCCGCATCCCCC
GAAGTGCTTCAGCGCAGCAGCCGCCAGCGGCCGGCATTTTTGTCTCACGGATTTATGGCACATGGTACCACAATTGGCGTCCTTCCACCACAGATGGTAC
ATGGTACCATAATCACGTCCTTCCAGCACAGATGCGAGCCGGCGCTGCCGACAACTGACCGACATAGTACCGCGGCTCCATCGGCCTAGAGCACAACGAC
GGCATGCAAGAGCCTTCGGTGGATGAGGACACGCGTCTCTGGTCGTTGTGGGCAACGATGTGAACAAGAAGTGCTTTGTGTGCTGCGGTCGGCATGTCGC
CGGCTTAGACGTGCTGGTCGGAATGATGTTGGCGGCAAGCCACGTCGAGGAGTAGCGTGGAGTGGGCCGAGCGTCGCGTTTGATGGCAGCACGGAGGCCG
AGGCGAGTGGCGATGTCATTCTGTACGTGCCGGCGTTGCCGACGACCTACCGACAAAGTACTGCGGCTCCATCGGGCTGGAGCACAGCTACGGCGTGCGA
GAGCCTTCGGTGGATGAGGACAGACTGGTGGGGACGGTTGGCGAGGACGACGGGCGTGATCTCGCGCTATTGCAGCGCTGCCGTGGTAGTATCGTGGCAC
GGCTTGTTTCCACAAGCACTGCTTGTTTGCACAAGCAGGTGGACGGCAGCGCCAGCGCGCGGCACCTCGACGACAACAACACCCTCGTGGCCGTGTTTAT
CACGCGCGGATCCGCAGCGACCACATCCGAGTTGCTGGGCAGGGGGCCTCTTCTGCCTCATATACGTATTGCCTGCTCTTTTCCGCTGCATTAGTTGAAG
GCGCTGATGAACAGCTTCTCGGTGCTCAATGAACAGGACAAGGACAAGACGCTGGACTACGACGCCTACTTTGTCTCGCAGGAGACGCTGAACCTGATCG
CGGTCAAGACGGGCGCTAGCATCGCGTTCGTGGCCACCAAGACGTTCGGCACGCGGTCCCGTTGGTGTGCGTAGGCAACAGCGACAGGACGGTCGACTTC
TTCGCACGCTGAGCGGTAACGTCCGGTACTGAAAGCCGGCCAAGGACCCCAACGTGCCCCCGTGTTTTTCGAGCAGAAGAACGTCGTCGGCTTGAGGGTG
GCGAGGTCCAAGATCAAGAGCATGCCGTTCCGCACGTTCAGTGGCGTGACGTCCAAGGACACGACGCTGAGTGGCCTGACCATCGACAACCGCGCCGGCA
ACGGCATTACTAAGAACACCGGCGGGGACAGTCACCAAGATGGAGTTGCACGGCGCGATGTTGGTGCTCTTCTTGAAGGTGCCCGTGATGTGGCAGGCGA
CTGCTGCTGCAGCTGGGTCGGCCGATCCTGTTGCTGCTGCTTGGAGACTGCAAATCGGTACTCATTTTGGGAAAAGCCCTCCCAACGCACCGCTCTCAGC
ACGATTTTTGGAGCTGCGGACGGCATCTGGGAGCCGCAGGTAAACATGGGAGGGGACCGGGAGGTTCCTGTTGTGGCGGATTACGTCGCGGAATGGCCTG
GAGTGGCCCGAGTTGCGTGTGATTCGGTAGCACGGTGACCGAGTCGAGCGCCAATGCACACTGGCGCTGTTGAGGCCATGCCCATAATAACAACACTCTG
CGAGAGAGGGGACTCTGTGGTGCTGCAGATGGATGATACCGGTGGCAAGCTGCGTCGAGCACTGATCCGATATTCGTCCCGTGAGCAGATGCATTGATCA
AGGCGAGTGAGGATGCGTTCGTAAACGAGTTCGAGCTTGACATCCTCATGCCAGTGCTGTCGACACCTGCCAAAAAACGATTGCTGCTCCAATCGCCCTA
ATGGCGCTGCGAAGGGGATATAAAGCTAGTAGCTTCAAGCTACACAAGACGGTTTGGGGCGGGTGACGACGGTTGAACCGAACATGGCATTAGAAAACAG
GACAGACCGGCATTGACAGGATTTTATAGTCGAATACTGTTGAAATACAAACTAATTACAAAAAAATCAAAAGAAAATGTATACGCATTCATTGTCGAGG
GCTACTAGCAATTGGGGTGGTTAACCGCCAAGTCCGTGCGAGGATTGTTTCGAGCTGCGTCGCTTTCCTGTAGGTTTCCGGAACTGCAATTTCTTGTCAA
GGTTCACCGGGATACTCTTTCCACAATCCCAGTGCTCATGCCAAATTGCATAGCACGACTTCTTTTCGCCGAATGACTCATGCCGCACCATTTGGCAGAG
ATAAACACTAAGAAACAAAACACTGTGAGTTTAATACCCCGCGAGTAAAATCAATGAAACTTCACTTACTCGCCGGTGTGACCGTTCGAACAAGCCCGAC
AGTACCACTTGGTATTTTCCCCCCTCTTTCCTTGTGGGGCCAGTAAGCTGCAGACCTTACACGCTCGATGCATCCGCTTGCGGTTAGGATTTCCGACTTC
ACCTTGAAAGTCTTGCGTTTCAGTGGGTTCATGGTTCGACAAATTTACCCTTCGACCCGCGGGTCTACACGGGACAACCAATGGGGGTTGAAATGGCTTT
TAGAGGAACAATGCCATGTTAGCAATCGCTTCACTGTCAAAAGAAAACAAAAACTGCTGCAAATAACGTACCATCGGTGATTCCAGCATATCTTCTGGTT
GGTTTGCCAGAAGTTGGGCATGTAGCGTTGTGAGAAATCCCGAATAACTCAAGCCAGACTTTCCTAGTCTCTGGTTGTGCTCCCGGTGGAAATGTAAGCG
TTAACGAGCGCTATGTCAAGCAACCCCAGGAACAGACTTCAGGAAAAGTTAGCAAACTCTCAACAAGCAACCAAAATTCCCGTCGTACTTACGTCTTGTA
GTACTTCTTGAATTTGAATGCCTGCTGAAGTGAAAACAGCTGAAGTCAAAGTTGATCGTGAATATCAACACCTCCCATGTTGTTATGGTGGTCTTTTACC
AATTTCGGGCAAGGAATATCGGTGGGTTCGCCTTCCACCCAGGTTTTTCAAACTACAAGATAAGCAATAACAACAGACCGCCAACATTAGATTAGATGAC
AATTCAACCAATGTATGCAAAGCACCAACCTGTAGTTAGCTGCTGCACACTGGCACCTGTCGCAAGAAAATGAACAGGCTTCGAGTCCCACCAGCAACAC
GCTAGCATATCGGGAGCTGCTTTGCATCGGGTCAGAAGATATGATCCGCGAGGAATATCACTGGGCCGTTTCGTGCGCTGTTCTTTCAGGTCCGATGGAA
ACCCAATGCGTCGGGTCTGAATTGTACCCACAGGTAGATCTTGCTCGATAGTAGTTCAAGCGCCAGCGCGACAGACGTATAGAACCTATCAATGACAACA
ATTCGATATTCTTGGCGCTCGCTTGGAAGAACTTTGTCTAGATTTCGTAGAACTGCGGCCGGTCCAGATTTGTCGTCAATTGTTTGTTTACCACCGAGAT
GAGCCTTTTTCCACAGTAGACTTCCAGTCTAACAATGTGCGCACATTACCACAGGTTAGTTTAGTAGATTCGTTCCTGTAAACAGAGTTTAATACATTAC
CTCATGCAGTAGGACGTGCGCGGACAGCAAGTCATAAAAAGCTTCGTTCCCCATTTATGAGGTTTATCCTTCATAAACATCCGTGTCCCGTTGAATTTCG
AATGGGAAGGAATCATTCCCTCGTCAACCGAATGTGGCCGACATTATTTACGTACAC