Description :
From Genome Similarity Track
Location :
Scaffold_6:60770- 86644
Transcript NameFunction/comments
Phypl_g277hypothetical protein PHYSODRAFT_469049
Phypl_g278conserved hypothetical protein
Phypl_g279hypothetical protein PHYSODRAFT_321830
Phypl_g280hypothetical protein PHYSODRAFT_321832
Phypl_g281conserved hypothetical protein
Phypl_g282hypothetical protein PHYSODRAFT_293759
Phypl_g283hypothetical protein
Phypl_g284conserved hypothetical protein
Phypl_g285integrator complex subunit, putative

Sequence
25874 bases(100 bases per row)
CAAAAAAATGGCATTCTGCCATATTTAGGACAGGCGATCTTCAAACGATGCCACTCCGCATCAATGAAGATTCGcgtgcgcttcctgctcggtgcgtcgc
cgtcgccttcgaggtcctccagctgctgctaaCGTCTTCGCCCACCACCCGCAGGCAacgcgtgcagcttcgtgtcgctgctgctgttgctggcggcgaG
CAGTGGTCAAAAGTGGGCCCGCGACGCCGTCAACTCCGTGGACATCGGGCTCTGGTTCCTCACGGTGCGGACGACGCTTTTGCAGCCGCAACGAATCTCT
TTACTGACGGACGGTATTGATTCAGGGGACGGGCGTGCGCTACAAACTCATCAAtgctggcgccgcgctcgacggcACCGACGTCACCTCGGCGGACCAG
CCTTTCACGCTCTTCAGTCGCTTTTGGTAAGGTCCGAGCCTGGTTAAGCCTTCTGCCGCTGGGCCGTGCGAACTGACGCTCAAgagagcagctcgttctc
gatTGTAGCCTCCAGCGATCCGTGGTGCCTGGAGGATGCCACGGCCACGCGAGCCTTCACGGTCTTGGCGCTGATCGCGGCCATCGTCAGCTTCGTACTG
AGCGTCATGGTGGCCTTCAACATCAAGATCCCCACGTGGAACGGGGAGGGCAAGGAGGCCACACTGGTCACCCCCGTGGTGTGCTCGCTAGTTGAGACGG
TGGCGTTGATCCCTGCCGTAACATTGTGGCAGCGCATGGTGACTGTATACGACGAGCAGTGTCTCGAAACGATGCAAATCAACACCTTCACGTGCATTAA
AACGGGCTCGACACACACCTGCGCCGTAGCTGCTATcccgtttgctgctgcaacctACGTGATGTGGCGGCTATCGCATTCGTACTACGTGCGCCTCTGC
TGTTGGGCAGAACCGCCGTCACCAAGCGTGCCTGACTtcgatgctggtggtgacTACGGTGTGCTAGGAAGCTAAACGAGCGGGCGGGATTGCCGATGGG
TTTACGCTTGCTGCGAAAACAGGCAAGGGGTTACGCGTACGTCTTCATCCGATGCTAGGAAACTGATGAGCAAGTGCACTTGGTTCCACCTGCTTGTACA
GACAATGTGGACGAGATCCTATCCGGTATCGCCAATAAGATTGACATCGACGCAAACGGCTCTGACGGTAGAAATGCATTGCACTGGGCTTGCACGTTGC
ACCGAACGAGCATTTGCCATGTTCTGCTCAAGAAGGGCGCGTCGATCAGTAAGAAAGATGTACGTGCTGTAGGAAGCTATGCATCAGCATGGAAGCTGGA
TGGTTTTGCATTCTGCAGATAACTTAGTGCTTCGTGGGGCCGCTGTTGTTTATTTTTTTTCAGGGAGATGGCTGGACACCTCTGCACTGGGCTAGTCGGG
TTGGCAACCTGGATATCGTGCGTCTTCTCGCAAAGTACGGCGCCAACTTGAATGTCCAAGACCGCTGGGGGACGACTCCATTAATGTTGACGGTCGTTGG
TGAAAGCAAGCTCGCAGCTGAAACGCTAATCGAGTTGGGTGCTTCGGTTGATGCACGAAATGTAGGTGTTCAACGGCAAGTTTGTTCGGATAGCCCATTA
AAAAATGCGGTTTAACATGTTCTGCGCTCAACCAGGTATTCGAGCAGACGCCACTAATGCTGTGTGCCGAAGGAGGAACACCTCTCCACCAGATGGGCAT
GGTGTTTTTGAATGCTGGTTCGGACCTCACCTTGCATGACGTACGTACAAGAGGCAAAGCTGCCTTTGTTCAGGAGCAATCGTTAAGAGCGATGCGTGTG
GTATCGTGCTGCAGGCCCAAGGCATGACAGCATTGCACTACGCCGCTTCCTGTGGTAGCGTCAATCTTCTGATGAACATGCTTCAGCAGTGCGACGCTGA
GTTGGTTGATAAACCCAACAAGGTGAGTCTTGTCAAATTAAGTTCATATGTTGTTGCGCATCTGACACGAATGCATCCAAACAGTTCGGAGAGACGTTGT
CGTACCTTGCTGTTCTTCACTCACACCCGAAGATATTGGACCTGGTCACGAATTGGCGAGAAGGAAACCCGATTGTTGCTtctcacgacgacgacaatga
TGCCAGTGAGGACGATGGTAGTACAGACTCATCCGAGGACGACGCTAGCGACGATAGcagcgaagaggaagacgattGAGTCGTGGAATAAACTGAAAGC
AGAATCGACAGCGCGTGGGGTGATGCAATGATAACAACAAAAAGCCTTCGGATCTATAAAGTTTGAGCTATCTCCTCTCTATTGGAGCTTCTCAAGAAGT
AATTTAGTGCCCTTCTGCGCGTCAGCAAGCTTCTTCAGGTCTCCCATCACAGgcttgagcgccttcttcaccaccttgGCAGCATTCTGGGGAGAATGCT
CAGCCTCCAGGAAagcgagaacgacgaagGAGCCACGGTTGCTGGTCGCCCACTGCGGCAACTGCTCTTCGACGGCTGTAAGCAGAGGCTCCGCCAACGA
GGTCTCCTTGATCAGACGGCGCAACGCGTAGTGGCCGTTGGCATCGCTGTGAAGaggctcctcctcctccttgctggGCTCCGCCACAACGACAGCCACG
TTATCTGCGAGCTCCGTGCTCTCGCTCCGCTTAGCGACTTCGACAATGACGTCGCGGCCTTCCTTCGAGCGCATCAGGGCAGCGGCGTTCTCAGCGCACA
TCTCTTCCAGCTTGGGCAGAAAGCCCTTCAGCAACTCCTCGCGACGAGCGTCCGGGTCCTTCTTGTAGTTCACCACTATGACGCTCGGGTCCTcagacga
cggcagcatgggcggctccagcagcacaaggtcATCCGCCGAGAGGTACTTCTTGTTCAGGGGGCtaagcagctgcagcagaatCTTGCGTCCGCTGGGG
TGCGTAGCAATAGAGAGAAGCTCGTCGTTCATCTCCGCCAGAATGGACTTCTGCACAAGAACGGAGTCATCCACAACGTCGAAGATGCGCATGATCACGA
GGTAGCCGCTGGGGTGGTTGCACGCGTCCAGAACCTTGTCCTTGAGAGTCTTAATGATGCGCTTCCGGTCCTTAGCCGCACCGAGCGAGATGCACTTGTT
CACCACACGAGCGCCGTTGCGGGtagccagcagcgccagcgaggcgTCGCGCACGTTGGCCACCATTGCcatcacgtcgtcgtgctccgCGTTGCACATG
TACTCCcagagcagcgactgcacaAAAGCCAGACCCAGGAGCTGTTTGTCCGCCATGCGGTTCAAAATGGTGGTCAGgtgcttgagcacgtcggTCTTCT
TGTCCGGGTGCGCGGCGATGATGTCCGCCAGGTTGCGCTTGGTCTCCGACTGGAAGTAGGCGAACTCGCGGCCGTAGAactccagcttgagcgccgtgaG
CTGCGACGGCTTGAGGTACTCCTGCGCGTACTCGAGCACGTTGGCCGCGATGTTGTGCGTGCCGACCTGCACGACGTGGCCCGTGAGGCACttgacgatg
gcggcgcggTCCGCCACGCTGCCGTAGCGGATCATCTTCTGCACGAGGAAGCAGCCGTACTGCATCTTGGCCAAATCAATGAGGTGTTCCTTCATCTCGA
GCACGATCTGCGAGCGGTGCTCGGGCTTGCCGTGCTGCATGAGCGACTGGATGACGCGCGACGCATCGTgcttggcggccacgtcgtAGATCTTGCCCTT
CACCAGCGTgtacagctcgtccacgagcgtggcgcgcttggccttgtcgacgtcgcgctcgcgGATGACGTTCCAGATCTGCTTGGCGCGCGTGACCATC
TCGTAGTGCGGGCGCTGcatcttgcgctgcttcttggccatcttctGGTCCACGAACGacttcttgccgtcctcgccattgccgcgcttcttgccgttga
agctgcccttgctgctgttgtagcccttgctgctgctgctgtagcccttgttgttgctgtagccCTTGCTGCCCTTGGGCTCCGACGTCTTCGCTTGCAC
CACCATGTCTGTCGCTGTCTGCCACTGCACCCGTTGACACTCGTGAAAAGCTCTTTGAGCCGTGGCCGGTGGCAACCAGTCAATTGCAGTTCGATTTGTG
TCAGTTTGGACGGACCAAATAAGACATTTGGTGCACTTACTGCGCAGACCAAATAATTGGTCATTTTGTGTGCGACACATAAACGATCTTGAAGCGGCGC
GTCGATTCAATGGCGATCGGCGTGCATTGCTAAGATCTGGCATTGCTGCGAGGCTGTCGTGAAGTATGGCCTTGTTCTACGACTACAATGTGGCGGTGCC
GGCCAACCTGCGGCAAGTCTGCTCGGTCTGGGGGGAGCTGGACCCCGTgctcgccatcgcgctggaGAACCGAGAGATCCACTTCTTCACGGATGAGGTC
TGCTAGCCATTAGATACTTTTCGTGGATGCTGGCGCATTGAGATTGTTTTACTGACATCGTGGCGTATTGGCCGCTGCAGGGTGAAAAGCAACAGGGGCT
GGAGAGCTACTCGCGCAGTGCCGACATCGTCACGATGGCCTGGCAACCGCGTGGTGGCGCACTCGCAGTCGGATGGAGCGACGGTATGTTGTGTGGTACC
CCAGTGCTGACAATTGACTGCCTTGAAACTGACACACCGGTATTTATCGTAGGTATGGTCTCGCTGTGGGTGTTTAAGGAGCAGACGTCACGCGAGGTGA
ACTCCCCGCACACGAGCCGCGTGTGTCTGTTGGAGTGGGCGCCAGCGGGCAACCGCCTCATGTCTGCGGACGAGAACGGGGTATTTGCCGTCTGGAAGGT
GGACAGCCGTTGTTGTCAGCTCACGCTCAGCACGCAGTATGCGCGCCAGGGGAGCTTCACCCATTGCGTCTTTGCCACTCGATCTGCACTGCCCAAGGAC
AGTACCGCCAAAAAGTAAGTACTTCCAAGTATTTTGTCTCCAACCGGTGGTCATTGCAGCTGATTATCGTGGATATTGCTGTTTGTTCAGCGACCTGTTT
TCCCAGCACGCGTGTCCACAGTTCTTTTTCGGTGGTGAAGCCGGATCTGTGCACTATGCAGACGATCTGGGGCATATTTCAGATATTCAGGTTCTGAATC
ACGCGATCGACTCGATGATGTTTTACGAAGAGCAGAACCGCTTCATTGTCATCACTCGGGCAGTGCAGCTTATCGTATATCAAGTGGGGGCAACGGACGG
CACGGTGAAACCCATTACGAAGGTCAAGCTGAGTCTAGCGGGAGAAGGATCGCTGCTTGAAACGAAATGGGCTGGCCCGGGGTTACTAGCAATCGCATCT
GGCGAACCGTTGGTGCGATTCTGGAACATTCGCACCGAAGAGAACAGCGTGTTGAGTCTACCCAAGTCAAGTGGGCTCAACTACAACGTCAACAACTTGA
GTTTTTCCCCACGCAGGCGCGTTCTCGTGGCCGGGACGACCCAAGGAGCAGTTTTCTTTTGGCGAGCCACATCCTTCATCGACACCCCTGCGCAGGGCAA
TGCTGACTCAGCTAACGTATCGTATCGTTGGGACCTGCTCTTCACGGCTGAAGTGGGGCGTGCAGTCACACGCATTGGTTGGAGCAATGCGCACCCTGCC
TTGTATGCCAACACTGTCGAAGGTGTGGTCATTTTGCATGAAGGCAACATGCAGCGTGCACTCTGCGGGGATACCGCAGTAATTCAAGTGCGGCCCAAGA
CGCTTTCGATTGAGAAGTTCCAAGATGGAGCGCAATCCGGTGTGACTATCACTCAGGCCACGATGGAGGCATCGCTGCGTGTCAAGGGCGTTTCGCATGA
CGGGTCGACCCTCGTGGTTTGGAATGGATCGAAAGCAGAAGTGTATGAGATAAAGGATGGAGATGCCAAGGTCACTAACCAGTTCAAGTGTTTTTCAAGC
TCGATGGTGCTAAGGGGTGAATCGATCTACCGCGCGAACGGAAACCACGTCGAAGTCTGCAATCTTGCAGGAGTCGTAAAGAACACTATCTCGTTCACGG
AGGCAGAGGGCCGACCGACGATGTTATCACTTCAAAGCAAGTTTCTTGCAGTGGGCACGGATCGTGGCCTCCTGCGTGTGTTCGACGTATCCCGTCGTGA
CCCAAAAGCCTTGGGGAGTATGGGCAACCTGCCTGAAGCTTTTGGTGAAGAAACCAAGTCTGCAATGATGCGATCCATCTGTGTCAACTCAGATGGCACG
CGTATTTGCATTCTTGCAGACCGGGTTGAAGGTGCTTTGCGAATGCGAGAACCATTGAACAAGCTCTTTTTGTTCCAGACGGACCTCAACATCTATCAGC
AGTTCGACTTTGGGCCGTCACGCTACCCAGTCTCGGTGTTCTTCGATCCACAGGAGCCTCGACTGCTCGTTTGCGAAACTGTTAAGACTGGTAACGATGG
AGTGTCGATCACAGTAGGTGGTGCTGTTGGTCGTCGAGATTTGAATGCTGACGATGGTCTAGGCGTCGGTGGTGCGGGTGGCAACCGAGGAAGCCAAGTA
TCGGACAAGGAAGTCACGATCATTTTTGCATCAAACGAACACGGTCTTCTGATGCAAGATAGTTTCGACCTTGATCTGAAGTACACTGCACTGCTAGGTA
TTCAGGTCCCACGTGTGTACTTTGTAGCAAAAGTGGATAATGGCTCCTCGGACGACTCCACCACTGTGGTGCATGTTGGCCGGACTAAGACCAACAACCC
CGTCACGAAAACCCCTACGGCTTACGACACGGTGAGCTACCTTCGAACGCAGATCATGCGCGATTTCACGGGGCTGGACAAGGTCAACAACGAGGCAAAG
CAAGCTCTCATTGACTTCTGTTACTTTATGACGGTCGGCAATATGGATGAAGCGTACCGTTCGGTCAAACTCATTGAGAATCCGTCCGTCTGGGAAAATA
TGGCTCGCATGTGCGTGAAAACAAAGCGATTAGATGTGGCTGAGGTGTGTCTTGGGAATATGGGCCacgctcgtggtgcagctgctgtgcaGGAAGCCAA
GAAGGAACCTGAACTGGAAGTGGCCATTGCCATGGTAGCAATCCAGCTAGGCCTGCGTGATGATGCAGCTCGGCTCTACCGCGAGTGCGGTCGCTATGAT
CTGCTTAATAAACTCTACCAAGCCAGTGGATACTGGAAGAAAGCGGTTGATGTAGCGGCCAAACGTGATCGCATCCATCTCAAGACGACCTATCATGCGC
TGGCACGACACTACGAGGAAATGGGCGACCTCAAGGAGGCGATGGAAGCCTACGAAGATGCTGGTACTCACCAAAAAGACATCCCTCGAATGCTATTCAA
GCTGGGCAAGGTCGATCTTCTGCAAAAGTACGTGGCCACCTCCAACAACCGCGATTTATTGATCTGGTGGGCGCAATTCCAGGAGAGTCAGGGTCAATTT
GACGCGGCCGTGGAAAGTTACCAACGCGCTAAGGACTATTTGTCCATCGTTCGGGTCCTGTGCTTCAAAAAAGATTTCCAGGCTGCTGCGAAGGTGGCGC
AGACAAGTGGAaatcgagcagcagcttacCATTTAGCCCGACAGTTTGAAGCCCACAACGAGATCTCCAACGCCATTCACTTCTTCGCAAGCGGTGGCTG
TTATAATCATGCAATCCGTCTTGCCAAGGAACATCGCATGGACGCCGACCTCATGGGTTTTGCCCTCATGAGCAAGCCTACTGACATGCTTGACTGCGCT
GCGTACTTTGAGGAGCAACGCGAGATGGAGAAAGCGGTCCAGCTCTACCACAAAGGAGGAAATGTGGCCAAGGCTCTCGACTTGTGCTTTCAGGCCCAAC
TCTTCGAagagctgcaccacctcaCGGACGAGCTCGGCGGGTCTGGGAACACGTCACCTGCTATTCTGAAGAAATGTGCAGACTTCTTCATCGCAAATGG
CCATTACGCCAAGGCTGTACACTTGTGCTTGATTGGGAACCGTGTGGCTGAAGCACTAGATGTGTGCATGCAGCACGACGTGAAAGTCTCAGAAGAGATG
GCGGAGAAGATGACTCCACCAAAGGGCGATGACACCGCCTCAGCTGCAGACAAGAAGAGGCGCACGGAGCTACTTCTGAAACTtgccaagtgctgcaagc
agcaaggTTCGTACCACTTGGCCACGAAGAAGTATACCCAGGCCGGCAACAAACTCAAGGCCATGAAGTGCCTGCTCAAGTCCGGCGACACTGAAAAGGT
GGTGTTCTTCGCCAACGTGTCGCGCAACGCTCAAATCTTCGTTCTCGCCGCCAACTACTTGCAGAATCTGGATTGGCGCAAGGACACCGAGATCCTCAAG
AATATCGTCGGCTTCTACACCAAAGCGCGTGctttcgagcagcttgcggcCTTCTACGCTGGTTGTGCTCAGGTTGAGATCGAGGAGTATCGCGACTACG
ACAAAGCGGTTTCTGCCTTGCAGGAAGCTGTGCAAGTGGCCTCCAAGTCCCGCACAGACGGGAAGGACGCTCTGCTCAAGCGCTACGAGAAGCGCATCCT
ATTGATTGAACAGTTTGTTGTCGCCCGCCAGCAGGCGAAGCGCAACCCGAAGGAGATGATGGAAATCGTCACGAAATTGCTAGAGGAGCCTGGTATCGAG
GAGGCCATCCGTGTGGGTGACGGGTATGCCATGTTGGTGGAAGCCTACTACGAAGAGGGCGAGCTGAACAAGAGCTTCGAGACTATGAAAGAGATGAAAC
GTAAGGGGCTCACACTCAAGTCGTACGTAGACCCGCGAGTAGTGGAGGCCGTTCAAGCGAAGCTAGGGGTTTCTCTGGGAGACGACAGACGCCGCAGACC
CCCACCCAGCGACAACAAGCAGCCTtcttcctccagcaggcCGAGCTCGCGTGAAGCCAAATCCAGTCAACCAGGTTCACGTGAAGCGAGTCGTCCAAGT
TCGCGCGAGGCGCATACGAGTCGCCCGGGCTCTCGTGAGGCAGCTATGAGTCGTCCAAACTCTCGCGAGGACAAGCTGCGtccaggcgacgacgacgaga
tcgaagACGAAATGGAAGAAGACATCGCGGAGGACGAGTAAGCAGCATCACGAGTTGCATGCCACCCACACAAGTTGCGTTTGGCTTTATGAAACACGAA
TCACTCTTTTACTTGGTAGCAGCCACGGACCCGAGGCAGAGAATTGACAGTCTCAATTGGAGACCCATGCGCGTCGTTACCTAGCGAAACGGTGCACTAA
ATAGCGAAATGGTGCACTAAACAAGTGACCCCCAACGTTCATGGTATCCGGGCTGAAAACGCGATTCCATGCCGAGTACTTCGCTACCAAACAAGGCAAA
GGCAGCACCGACCACCACGCAACAGAGAGCAAATGCTGAGAGCATTGCGCTCCACACGCCGGCTACTGTCGCTGCCGACTCGTCCTCCGAAGATAACTGG
AGTGCTGCTGACCAAAAGCCAGAGACTACTAGTAGCTCACTAACTTTTGACGATGACTTGCTCAGCGCCATGACGCCGTACCTTACCTGTCAGCGATGCA
ACAGCGTGACGTTCATCGACGTGCAGCGAGTACGGCGCAAGGTGGACCAACTGACCGCCTCCTTGCAGCCACCCAATGAACAAGAAGACACCACCTCTTT
GTACGAGCAAGTACCAACATGTCCTGGCTGCGGGAGTACACGATACCTCCGCGCGGGGGTTGTGAGCTTCCAGGAGcagatcgaggaggagcgaAATGCC
ATCAAGGAGTTCGAACGTCGACGAGTCCCAGCTACTGCTCTGCTTCAGCGCATTGCGCGTGGATTCCTCGGGCGGCTGAAGTTCCGTCATCGTCTGGTAG
AGCGTGAGCGATACCTGCGAAAGACCAACCGGGCGGCTACGAGAATTCAAACACGGGTGCGAGGCATGCAGGCGCGAAGACGAACGGTCATTGAGAGGTG
TCTGCGTATAATCCGCTTTATTGCTCCCCAGATACTCAGTTATGCGCTAGCTGCTTGGCCGAATGAACCACCAGTCTTCTGGTACGCCAACGCTGCAGAG
ATTGGCGTCTTTTACTGGCATTACAGGGAGTATGTACGACGGTCGGGCGGGAGACCTTCTCTGATCAAGGTGGAGAATAACGTGCTAGAGATCACGAGAC
GCGTCCTGCGCCGCGAATATGCTCTCGTCAGCCGCATTCAAGCGCGATGGCGGGGACTCACCGCACGGATGGCCTTCCGCGAGTTCAAGCGGCAGAAAGG
GTGGTTGAAGGGTATTCGACAGTCTCCAGCTGTGAAAATTCAGCGTTTAGTCCGTGCCGATGCaagtcgtcgccgctgtcgagCGTTGCAGGTGACCATC
AAGTACCCAACTCAACGCGAAGCCTACCGCAAGGAAATGGCAacgcgcgagcagcaggcgaaTGCAATCGCCTTCCGTCAACGCCTGATGGCCAAGTACA
AGCAGCAATTTCAGATCAATCGCACTACGAGGATGATCGTGCAGCAAGTCAAGGTACCCTTGGCAGCCAAAAAGTATGGGACTGATTCCGTTGATGAGGA
GGATGAAGGGGACTTGGGCCCGGAGACGAATCCACACATCCAGCACTCGCTCAAGGGTAGAAATGGAAGAAGCAACGATGACTCGGGGAAGCTGAACAAG
GCGTCGTGGAGTGCAGCCAAGCTACCTCGAAACCCGAACGCTGTTCGGTTTGCCGAGATAAGACGGCAGCTCGAAGGCCAACACGGCAAGGTACGCGGAC
CAAAGCTTCACATCCTTAAAGCGCAGATGTACGCACCCTCCTCGTCAAgcaactcgtccacgaaggTTTCGGTTGACGACCGAGCTTGATGCCCAAACGT
TTGAAGATGTTGAAGCCCATTTAATTTAACAAACTTGCCAACACTGGGCcacagcttcaacagcgtGAGAGAAATACTCGGTAGCTCTGTATGTCGTATA
AGAAGTAGCACGATCAGGGGCGACTAAGTCACTAACTTgtggcagcacgagcagtgaacgcacttcaacatggctacatctcGCACATAAGCGGATAGAC
TCTGTACCCATCCGCACTCCAAGCACCAGGTGGTACAGTACCAGGAAGGCGTCATTCTCCAACTTGCATTCAAGCGAGCAGACCGCCAGCCCCAGACGAC
ACAATGAGCATCTCGACGGGCGCCACGGAGTGCGCCGTGGTGGCCTTCggctgcaacgacgacgggCAGCTGGGCACGGGCGCCAAGCGCCGGCCGACgc
tggccatcgacgacgtgtcGGCCTCCAACTTCcccaagcagctcggcggcctgatgggcgaggagatcgtggcggTCTCGTGCGGCTCCCGCCATACGAT
GGCGCTCACGGCCAGCGGTGCCGTGTACTCCTGGGGCTGGGGATCGGTGCGTGCCCACTGTATACTGTACCTAGAGCGCAATACTTGCTCACCGACTTGC
TGGATGTGCTTTGTTTGGGCGGTGCGATGTAGATGGGCCAACTGGGCCACGGAGACCTCAAGAGCATCAATGAGCCCCAGAAGATTGccttcttcgagca
ggaaGGACTCGTAGTGGACTACATCTCGTGTGGAGGCTGCCActccgccgccgtgtccagcgacgGGACGCTGTACATGTGGGGCGAGTCGCACTGGGGT
CAGCTTGGTCTGCCCAAGGAGTTCGAGGCGGCGCacgagtcgctgccggtCAAGTGCCCGATGCCCGAGGGTGAAGCGGGCGAGACGATCGTGAAGATCA
GCTGCGGTGGCACCCACACGGCGGCGTTGACCAACCTGGGACGAGTCTACGTGTGGGGTCGAGGTGATAGCGGCCAGCTGGGTATCGGCTCGGCGTGGCT
GAAGGACACGGAAGACGAGGGTCTTCTGGGAGTTAGCCGCCCGCATCTGCTGGACGGATTCAACGGCGAGAAGGTTGTGCAGGTTGCATGCGGCGCTTTC
CACTCGGCTGCTGTGACCGATCACGGCCATGTTTACATCTGGGGAAAAGAGGACTACGGCATGCTCGGCGTTGGCCAGACATCCGACCAGCAGACGCCGA
AGCGCatcgagttcttcgacgaAATCCCTGCGCTGTGCGTTGCTGATCttgtgtgctgcttgcttgAGTTTTGCTCGCTAACGAATGTCTTTTGCAACGG
AATTACACAGGCGCGTGTCTTGCGGTGGCTGGCACACGGTGGTGGTCGCCAAGTCTGGAGACTGCTACGCTTTCGGACGGGGTGAATACGGCCGATTGGG
CCTCGGTGACACAAAAAGTCGTACGCGGCCTCACTTGGTACGGAAGAGTGCATGTTTCATCTGTGCTGGGCAACGGTTCACTAACATCCTCGATTTTCTT
TGCTTCACAggtgaagacgctgaagggAAAACAGGTTATTCAGGCTGCGTGCGGTGGCTCTCACACTCTGTTCGTCacgagcgacggcatcgcTTACGTT
GCAGGACGACCCGAGTGCGTACCAACATTGATCGTACAGTATTTTGCGTTGTGGACGAAGGGGTACTAACCGCGTTTATCTGTTGCAGCCACGGACGGCT
GGGACTGGCGGACATGAAGCCGTTGGCAGTGCCTACACGCCTGGACCTCGGCGTGATCCCCGTTCGCCAGGTCTCCGCGGGCGGCGCGCACTCGGTGGCT
TTGATGCACAGCTCGCGCCCCATCTTTTCGCCTATGATCTCGCCGATCCCCACCAGCAAGCCCGTCCCGCATGGCGAGCTCTAAACGCGTTGCCAATTAG
CATACGATAGTGCGACCAGCAAAGAGCGCCGCTCAACAGCATTGAGACGCTTAGACAGGAGCGACCTCGCTATTCTAGACAATCAACATGGCTTTTGTAC
AGCAAGTTGCAGTTTCTCGAAGGCGATAGAAAGCAGCCATATCACCCCTCTCAGGGTACTAGATTTCAGAACTTGATTTCTCTTATCTTTTAATCTTGGA
GGTACTTCCATCCGATATGTGTTTCCAAAGCCGCTGTGATTGCAGAGAACTTCGCACGTCACTCTCGATCCTTTGGCTAAGCGAtgagcgaggacgccgc
gtcttcgtcgtccagcggccACTCGCCGgaccacagcaacaacccCGCATGGTCCTCGGCACAGGCTCTCGAGCGAGGCCATCGACGCAGCGTGGTGCGC
ACCACCGAGAAGTCCGTCGTGTTCCGAGTGCGCACACAAGAAAAAATGACCAGCGCTCGAGGGGGCAGAAACTccaagcagacgctgcgcttgGCGCAGA
GGGCAGCTACGAGCGGGaccgacgacaacgacgtcgacgagacgctggtggagctgtacgccgaggcggagcgcaagaagcagtggctgatcagcgagga
ggagacgttCCGACGAGGCCAGGAGCGTTTGCGCAGCTTACAAGGTGAGCACACAGAGCTTGTACGTGCTCTGGAGCAGTGCAAGCGACGCAGGAAGGAG
CGACTCCGTATCCGGAAGATGCTACGAGGGCCTGAGGGCGAGAGTGAGGACTACGAACGTGAGAGAGGCGTTGCGAGCGACAGTGACAGCGGCTACAGCA
GTCACCGtcgccgaagcagcagcagtcgacacCGTCGACCGCGACGAGATGGCGCTAAGAAGCAGCGCAAACTCCTGCGGCGATTCCAGAACGATGTGTC
GCTGCggttccagctgctgcagtccgagTGTCGGCGCTCCGACCTGCAGGTGgacaagctcgtggccgaGTTGCGGCGCGAGTACGCCGACTCGTGTCTG
TTTGGCAACTCATTGAACTTTTAACCCTTTTAAGGCGAGGCTGCACGTCTGTGTGAGTGCATGTACGGACGTACAGTGCGTGGTGCCAACCGTCCTCACC
CCTTCATAATTCCTGCCAATCAAAACGCTTCCCTCCCAAAAAACCGTCCGATGCTTCAATTCAAAAGGCCGTGCGACTATCAACAGCCGGGCAGGCCTCG
ATGTGGGCTTCCGAGGCCGGACTCAACGACGATGACCCGCGCGAgatccagcgccgacgcgaGGCGTACGCCCGAGAACTGGACCACCAGatcgcgctgc
gccgcgcgcgtcagcaccaggagcagatggagcgcgaggaaatggagcgcaagctggcgccgagcgagcgctcgccGTCCAAGTGGCTCGTCGAAGGCGG
CCACCTGGACCTGCCGACGGCCTCTCCGTCGCCCTGGAAGTTCACGCAAAGCGTGGAACTGCACGacaagcagcggcaggacCGAGGAGCCGCCACGGGC
GAGGCCAAcagcgtgtcgtcgtccCATCCGCGCTTCCGGGTGAcggacgagggcgaggccAGCCAGAGGCTGCgggagcgcgcgcagcagatgcagtgGA
AGCGGATcttggacgagcaggtgcaggagaaggcgcggcttaaggagcaggaggagaccgagcgccgacgcagcGAGGAAGATGCGGCCAGGGAGGAGAT
GCGCTACCttcgagagcagcagctgcgggcgcaacgacgactcggacaaTTCTCACCCGCGGTAAATGCTGAAGCACTGGAGAACAGGGCGGAGACGAAC
GCTCCGTATCACGcactgccgtcgccgccggaCTTGACAGCGAACAGACAGAGGAACGACTTGACAAGTCGCCACAGCTTTGCATTCAATAACGACTCAA
GggaggacgatgacgaggcgATGTATTATCAGAGAGGCCGCCAGTATGGCAACTTAGGAGTAGCagaagcgctgctgcctccgcctGCACCGTTGCGGGT
TCCGATGCCGCACGAGATTCGACGGAGTGTGGCGAAGGATGACCGACGTGACATATTTGATCAGAGCACGGTGAGTGGCATTGCTGGAAAGCAGCAATAC
CTACTGGACATTGATGCACAGCCCTCACGTcagcaactcgagcagcaaagCCGTATTATCGACGAGTaccgctcgctgctggcagAAATCCGCCGCGAAC
GTGAGGAACTACGCCGAGAGCGAGACGAGGTACGGCGTGAgaaggaagagctgcgcgtgcagcgggcgcagttgcagctggagaacgaAAAGATGGCCAG
TCTCGTGGATGCCCAGCGAGCTCTCAACGAGCGGCATCAGGCGGACCTCCAGAGCCAGCAGACACAACAAGctctgcagcaagctcaacAGCAAGCTCAA
CAGCAACAGTACCAGCCACTTTCTTTTCAGCATCGACTTTCACCCGTTCAACCTGCGGGCTTCGAATTGAATAACGCGCGCAGCTCATTCGAGCTCCCAG
TTTACCAGGACAATGCTCCTGAAACTCAAGCGTATTCGCGACTGAATCAGATTCGTGAGACCCTCGGCGATTTAAACATTCATGATGATCAGCCTCAGCC
AGCAGTACAAGGACGACGGAGGAAGCCACCGAGCCCGATGTCCATGGCGGACTTTTCTACGCCCACACCTCAGAAACGCATGGCCATCAACGCTATGGAC
TCGCCGCGCTTCCAGCGGCTGTCCAGGTACCGCCCGATCCCAGTCGTCCCCGCTTATGACGAAAGCGCGCTGAATCAGTCTTTGGTTGGCGAAAGTGTCT
TCGTCCCGCTGAGCCCCAAGTCGCAGAACCAAACCAACAAGgggccagcaccacgcacCACGTCTTCCCCGACCTCCGCGGACAGACAGGGAGACAAACG
CCGTGCGAATCCTCTTCGAAGCAGTCGCGTCATCAAAAGCCGAGGCTTCTACGACTTCGAGCAGGACATCAAGAGCGAAGACAGACTTGAGTCTTTCGCA
AGTGAATCCGTCAGTGGCAGCGTCCTTGAGTCAGaccttggcagcagcttctacggcgacgacgatgggGAGGAGAACGATGCcgaagacgagctcgaca
gcaCAGACTCCCGCCCCGCAGCGAGCAGTGGCCTGTTCCAGGTTCAAGTGCTGGTGTGAGACTCCAGCTACTAGCTAGTACCAATATGTATTCATCAGAA
GTAAGAGTGCGCAACGAGGGAAAATAACTGCGCACAATGCCACGACGTTTTTGCTTGAAGTCGTCGCTTTTTAGCACACGTCACAGACTAGACATCCATG
TGGTACACACCAAATTGATGGTTGGCGCGATTCGGCTCAATTTGCTCGACCAGCACCAGagtcgaagatggcgttcCAGTTCCCCGTGgcgagcggcaag
aagaagaaagtgCAGGTGTTCGAGTGCCCCACGGAGACGTGGAAGGAGCGCAAGCCTCGCGTGGCCAAGGTTCGCACAGGAATTCCGGTGTGTAGCGCTG
ATTTTCGTTGGTTCGGGCGATTGACACACTCTCGTTGTGACTCCAGAGCAAAGCCGAGGGCGATGAACCGGAGATGACGCTGCGCCAGGAGATCCGCAAG
GAGTTCGACGACACGTTcgactcggtgctggagtttGGTGCGTTGTTACTGCTGAGTTACTGCGAGTTTGTTGATGCGGTgagtgctggagacgctAACA
GACATGGAATTGGGCGTTGAttttgttggtggtggtgacaGCTACGTCAAACTTGAAGGGCAAGGAAAAGAAGGCGCATGAAGCCAAGAAGATTGAGGCA
CTGGGCGGCAAGGCTGCCAAGGCCCGCAGTGTGCCGTACAAGGTGCTCATCGGAATGAAGACCAAGGGTgcggacaagaagcagcgtcgcgaGGACCTGG
TACGTTCTGAAGATGCAGTTGTTGTGCACTTTTTGGGTGGGTGGTGGGTGTGGCCTTCTAACGCTTTGGGATGGAATGCTTGTTATCGTGACGCTGgggc
gtgcagctcaaggagtCGGATGTGGTGACGGGCAAGCGGAAAGCGAGCGCCAAGTCGAGAGaccagcagaagcgcaagaaggtggaCTACGGCGTGCAGG
CCACCCAGGGACGATTCAAGCGCGGTGTGCTGGACGTGCGGGGTCTGTAATATATTGTACACGAAGTCATTCAGCCAGACATTTTGATAAAAGCTTCAAA
AATACCAGCATTGCTCGGTAGTTTTTCAACATAGTATTGGCTGAAGGATAGACCTCGTAACTTTGAACGGAACGTACAGTCGGTTCACTTGTTATGTGTG
GGTGTGCTCGCAGTAAACGACAACTCTAAGCTTCAACGCCGGTACCTTGTACCACTCTAACTATCGGATCTTTCGCAGTCATCGCTTTTGCCTGTCGAGA
TGGCGGAGGAGACCAAGACTCACTTCAGTAAGGATACCTACACATAGCGGACAATATACGTGACTAAAAGATGGCAATGCTCTAGCGTTTTCGTTTTTCG
ACGCGGCGCACACGGACGGCTACGTCGCCCCGACTATCGGGCCAAAGAAGGAGTTCAAGCTCAGTGACAACCAGTTGACTTGCCACCAACAGGGAAAAGG
ATTCTTCTcagatgaagaggaagacgagtAGGCCTCACTGTTCATTTACCTCGCCAATTCCAGTTCCTATTTGGCCTGACAACGGATATGTATGTGGACA
GAGACATCGTGACGACGATCCGCCATTGGAAGCAAACCAGCACCAAGGAGACCAAGACGAAATCCCCCCAACAACGTCGAGAGGTGCACGATCTTTTCGC
CGAGCGTGCGAAGAAGGAGGTGAGCTTGAGACAATCCTACAGAGGAATCGGTATATCTTAACTGTAGACGCACCATAGGACTCAACATTTTTGAGGTTAT
TGAAACAGAGCGTCCCATCCGAGTCGGATAGTACCATTCCCGTAGCGAGCGACAACATCCAGCTGAACCGCCTTCTGTAAGCTCAAGACTGCTGTAAAGT
GGGATATGCTCGCTGCATGAAGTTAAGTTGAATATTGTGGTTACCTGTAGGGATGACTACATGCTTGGAGAAAAAGGGGATCGCATcatgcagcagatgg
aggatCTGACCATGGACGACCCGCCATCGCCTGCCAAGAAGCCAAAGGAAAAGTCTCAATCGCAACAAAACGATATTTTTGGTGGTGGCCAGAAGTCGAA
CTCTGAGCCGCAGGAGCCATCGCTTGACCTGGGCGCTATGATGTCGATGGAGGACTTCGAGAAGTACATCGCTGAGAACTAAATACGCCGATAATATATT
AATCTTGGACGACCAATCGATAAAGTACTTGCCGCCGGGTTCCCACAGTTACACCCACTCGTACAAAGCAATCACCGATGAACGCGAGCGGTTCCGGTGt
accacctgctgcttccgaATCCACTGACGGAACCCGAAAGTTCCGTCACCACCAATTGACTCGCGGACTTCATTTTCAAGGTCGAGATCATCGTCGACCA
CAACACACGAACCACGATCGCTCAATGGCAACGCGTCCGCTTCGCGTGGTTCCAGCTCCAGTGAACGAGCATAACGACTCTCTTCGCAGGAATACGGCAG
TGATACGTGCAACAATTTCTACAAGGACAAAACAAAACGAAAGTCAGAAATCTGACCATGACAGGAAGTTGCGCTGCAACGTACATCAACATTCGCATCG
TTCTGGAGAGTGTAGGCAACAGACTGTCGATGCAAGATTTCCATTGACAACTCGCCCATTCTTCTCAGCCGGTTCGCATTTACCAGACCTTCCTTGTCAA
ACGCAGGCAACTCGTTCAACCCGACGAAACCCTAACGCATAAAGACAAAGTTGGCACTTTGATCACAGCATACCTACGAAACCCAATGCTCACCTGAAGG
TACAAGCCGATGTAAGGCATGCTTGGGTTGGCAGTTTGGCGCATCAAACGGTTCATCTCGCGACATCCCTTGTCCGAGAGGAGTTGCATCTCGTTCATCT
TTTTCTTCGCATTCACGCTTAGCTGCAGTGCACCAACGTTAAAACGCGGTAAGGCCAGGAACAAACTAGACATCGTGCAAACACGACATCAGCGAACGTA
CACAGTCGATCGTCTTTCGAAGCCGCTGCACCGCAGTTGATTGCAGCGCGTATAAAATCGATGCCAGCGTATCGTGGTTGTGTAATGACATACAATAATC
GGCGGCCTGATCATATATAAAAACCTACGGATTAGCACGCCGTATACCATGCGATAGGAACCCAACATTGTCTACCTTAAGATAAAACGAAATCACATCT
GCGCGTTCTTCGGGAGTAGTTTGGACAAGAACAGCGTTGATCACGTACGCAGAGATCTACATAAAATCACGTTAGGAACAAAGCCTGTTAGTGAACATCA
ATAATACTCAACCTGCATCGCTTATTGGCATCACGTACGTGTTGAAACCATCGTTTGATGCTGGTGAACTCAACGGAAAGCTTCTTTTTCGAGCCTATCG
AAATAAAATCTTGGACTACAGTATAGATGGCAAATGAGCGTACACAGTAAGGATTAGTTCCTTTCATCCTCACACTAACAGGGTACGGGGCACATCGCAT
CTCACCTGGAATCTTGCAAAAGACCGCGTGCGTTAGAAGTGTGCACTGCTCTGCCCACTGCTCTGCATCAATATATCTGTAGAATAAAACAGCAAATCAG
CAATACTTCATTCCCAAGAGACTAAACCCCGTACTTACCGGTGCAAATGCATTGGGAAAGGCTCATTGGATAAAGGTTTGACACCTGAGTCTGCACCGTA
GATCTTGGTCATCATTCCAGGGATCGTTTTGTAGTTCACGGCGTAGtttccagctccacgaagaGAGAAGTACTCCCTGTAGAGAGAGGTGTACTCTTCA
ATCAAGGGCACCAGTTTGTCCTTCGAGACGTCAATGTTGAGGCTAATGAGGCTGTAGAAACGATCACGCAGATCGTCAGCTTCCTTCGTTTCTGACTTCC
TGAACAGCAATATCATGATGAAGAGTCGGATAAGTCCGTGACCTAGATAAACGCATCAACGACAGCATCAGTGTCCTATCCACAACATGTCCATACAAAC
GCTAGCAAAGTATTATACATACTTTTGATCCCATTCCGAACATGTCCGCTTAGTCGATCCACCACTTCGTTCAGGCTTGAAAAGTTGTCCAAGAACAGCA
CGaacgccaccacgtccactAAATCCACTTCCATTCCAGAAACGATTTCGCGAACCAAATCATCAATAGAACCTGGCCGTGCAGATCGCGAAGCGCGATT
GATCTTGTTCACAATCTTCCACGAATTGTTGGGCATTTGTGTGCCCAGATATCTTGCAGCCTTGTTTATCTCGATACGGTGGGTGTAATCAACAGACGAG
CAGCCAAATATGTCCACATCAACGCCATTGCCTCCCCGATTGAGTGATCCCAGCTTTCGCAGTAATCCGACCACGTGAGAATCGCACGAAATGTTTGCTA
GGTGAGAAGCCTGGCGACCGAAGAGATCTCGCTTGTCAAGGCGACAGCCAGCGCACGTCAAAATCTCCAGGCACAAGATTCGGGCGTCACCATTTCCGCC
AGGAGCGGATGCCAGTAGAACTGTCGCTGGAGTCTGCCCATACCGATTCTGAACATTGGGGTTTGCACCACCTTGCACTAGCCGGAGAATAATATCAGCG
TGAGCTAGAGCGGCAGCCAAGTGCAGACTGGTGTTTCCGTCCAACGTGGGCGCATTCGGCTTCGCACCCTTCGAAAGGCAGAGCTCCACGAGTTCTGTAC
GCTCACTCTTGACTGCAAACTCCAGAGCTGAAAATCCATTCGACCAAGCAACGTGGTGGACATCCGCCCCAAGGGCCAGTAGTGTTGCAGAGCCTTCGAG
AGATGCCCTGGAGCACATGAACATCAACGGTGTTAGGCCATGCTTCTCCGTTGCATCGAtgtcagctcctgcatcgATCAGGCTTTGAATAATCAGCGCC
ATGTCGATTGACTGCTTCACGACGTGCAGCGGCCGCCTTCCTTTCAAATTGCACAGATTGGCATCTGCTCCCTTCATAATGAGATAGTTGACCATTCCGA
GTTGTCCGTTGTGCACAGCCGCATGAAGAGGCGACCCTTTGCCGGATACAGGAATGAATCCGTAAACCTGCTTTCCTCGAGACTTTTCCCACGAGCAGAG
TGTATTCAGTTCCACGGTCGATGATCGTAACCAACCAGCGGAGTCCAAGTCGCCACGGCGAGCTGCAATACACATCAAATAGTGGAACATCTCCgagtcc
agcgacagcagctgaTAGTAGTAAAATTCCGTCATGAAGGTGAGTTGCTTCGGCAATGCTGCAGTCCGAACGCGCTGAATGATTTTGTCGAAAGGCATTC
CAATCACTGGTTCGTGGTTAATCGCGATCAATGACAGTCCAGGTACGATGGCAGCGCTCAAGGCTGCTTGAGACAGCTTCCGAACACTGTATACAATGGC
TCCTCGGCCGTTTCCGTCCGTCGTGAACTGAATGCCAACATCATTGGTCGAGATGGATACTGAAACACGAGATCCTGCCAGGGCCATGGAGTCAAACTGG
TAGCTTTCGTCTCCAGTCTCAAAACACTCGACCCATTTGATCGCATCAAGAAAAGCTGTCACAATGTTTGCTTTGTTCTGGCATGCTGGGTGGTGCTGGT
AGCCATACTTCAGCAATGCCCGAAGAATCGACAAGTCACTCAGCGAGGACAGCGTAACCACATACCGAAAAACCGCCGTCAGCGCCTCGTCTGATACCTC
GAATAGCTCGCCATTGTACTGAGCAATCGCCTCCGTGATGGCCCTTCCAGCTGATAAAATGACCTCGAACTTGTGCGTTGGGAGCGACACGCAGTCGAGC
AAATTGATCGCACTAATGGCTAGTTTCCAATTGCACACTGACAAATCCTTCGAGATGCCGAAATCCGCCTGTgccttctgcttcagcaccttgacattct
tctccaagctgctgcgcctcgatTTCACCTTGTCCGTCTCTAAGCTCGCGTAGGCCTCCGCGTACAACGGAATAAACACGCGGTCCTCCACATGTCGACG
AATGAGGCGCACGAGGTCGTTACCTGGCAACAATTCAATCTCCAGGTCCTGATAGAACTCCAAATGGTGGCGATCAATGATCGCATCGTCTAATTCCACG
ATAAAGTTGTGAATCGCCGCGTACGAGTGGTCGTGCTCGTACTCCTTGAATTCCACCAAGCTCTTGGCCACCTGTTTGTCCGTGATGAAGATCTTGTTCA
AGTGTCTGGTGACCGCATTGGACCCCGCTTTCTCTTCCGTCGCCGTCAGATCCATTTCGTAACTGGGCGGTGCTACCCTCCTCACCGACCTCAATGCAGT
CACCCAAAGCTCCGCTTCAAACTGACTGCAGCAGTAGCACAGCAACTTGTAGAAGCCCTTCTCGATCTGGAACACGTAGGCCTTGTCGGCCACGCGAAtg
tccacgtgctgcacggacacgacgccgtcgttgaGCTGCATGCAAcccttgatcttcttcctgcCCTTGTTCTTGTAGTAGGCGAACGTGCCGTcggaga
agagcacgaagaagcgcgtcttccagctcttccacaTGTGGCCTTGCTTGGTGAGCCAGCCCATCTTGACGAAGTTGCCCACCTGCACTTGTGTGGAGTA
GAAGGAGTCGTTCAGCAGCGGGTCGGAGCCGTGGCGCACCAGTCGGAAGCCTTTTtctcgctgcacgagcgtctgcgGCGCCTCCATGgcgtccgacgac
gagcgcgaggcgcgCGACAGCGTGCGGTCCCCGAACATGGAGGCCAGGAGGCTTCGGCGCTTGTCGCGgtcgcgctgctcggtgaactcttcgacttcca
gctccaccacgtgctgctgcgcttggctCTTGGCGCGTGTGCTGCGGCGCGAGAAGTGCGAGCGCTTGCTGGCCTTGGGtgcggcctcgtccagcagtgg
cggcggtgacgGAGGCCCCCACGGATCCAGTGCGGAGCTCTTGCTCTTGTGGCGCCAGCCTGAAGCCATCGCGCGCGTGACTTGGCTGACTGCGGAATGG
TACCCAGCTCCGCTATTTTTTATCAGTGGGAAAGCAGCTGTTTCCTCGTTTACCGTGCACAGGCTTCTACGGGACACAACTGGTGAATGACTTGAGGTTG
TAAGTGGGAGTGCACTGTGTATTACGGTCCACTGGCAGAAAATCCATCCTACACTTTTCCGAGATGGACTTATGGCTGCGTTGGACTTCCACCAAAGCTC
GCTGGTGATCCCAAAGCCAAAGCTCGCACGCATGTTGGACCACGGGTAGGTGGAGTGTAGTGTACCTACCCGTCGTCAAAGTGCCAGCTCTGTCGTGTGT
CGACGCCGTGCTTGACGAGGAACTCGACGCTACGCTGCGTGCGTTGCTAAGAGACGTAGCAACGATGCGGGCCAGAAAGCGAGAGGGCGATGCTCACGCG
ATGAAAACCCGCAAAGGCGGACTGAAACCACGTAGAGGAAGCTCGCAGTGCTCAACAATTTCTGCAGCGATTGACCCACTTACGCCCACTCCCAGCTGGT
TTTGGCTCCAGCACGGTATCGATGACTCAGCGTGCATCCACTCTACACAGTGCACTTCAAATTATTTTAGTACAGGAAATGGTGGAGCAATATAATATTT
ACcccccccaccaccacccaCGAAGATGTTTCCTTATGATACATTCCATCGACTTGCACGGTAGAGGTTAAACCAGCGATTTCTCTCGCTTGCGTTTTCC
GTCAATGGAGGTTGCCGCTCGAAGCCGTTGCCCTCTCTGCCCCGGACTTCTCCACGTTGAACTTTACAAATTTTGGTCGCTGAAGAGAAAGCTGTGTCTG
CTGTTTCGGGCAAGAGCTTGTCCTGATTACAAAAGGTGTTAGGTTTCCTTTAATTTGAACATGGAAACCCCTGAGCAAATCGCCGACTCTCCAACTTGTT
ATCCGTGGTGAGAAAACAAAAGTATCGCACGCTCAATCAAGTTGCAAGGCTATCCTTCGCAACCCTCATCGGCAATGCCAAGCAGAGAACTTCGTTCTCG
TCATGGTATTTACTAAAATACAAACGCTTCGTACACCGCTGTATCCACATCAAACTACAACGTTGTGTGCACCACACTACATTAGATACTTGCCTTTTTT
GCGCCTCACATTGCTGAGCTGGTCAAAATGTGGGCTGTTCGtcgcagctccttggcgtccGCGGGGCGGCGCCTCTCGACGTCGCAGTCGATCCGCGCTG
CGCCCTGCGCCTTGCGGTCCGTGCTGTGGGCCCccacggagaagcaggcgccGTCAGACGCTGTGGCGCCCAGTcaccagctgctggtgcgcgctGGTTT
CGTGCGCAAAGGCGGCTACGGACTCTTCGCGCTGCTACCGCTTGGACGCCGCGTGGTGGCCAAACTAGAGGCACTAATCGACGACGAAATGCACAAGATT
GGCGGCAACCGCGTGGATCTGAGCGTGTTGACGCCCAGCGAACTGTGGGAGCAATCAGGCCGCTGGCAGAATCGCGGCCCGGAGCTCATGACGCTCGAGG
ACCGACGCGAAgatctgctggtgctgggccCCACGCATGAGGAGAGCGTCACGAGCCTCGTGGCGGCTCACTATAACACTGCGGGAGCAGCAGACTCGTC
CCTGAGGCTGTACCAGATCGGCCGCAAGTTCCGAGACGAAATCCGTCCGCGCTTCGGTCTGTTGAGAGCGAGAGAGTTCGTGATGAAGGACATGTACTCG
TTCGACGCTTCGTACGACGGCGCGTTGCAGACATACGAGGACGTCACTGCTGCGTACCATGAGATCTTGATCTCGAGACTCAAGCTGCCGGTCAAGCGCG
TGGAGGCCGATTCGGGAAACATTGGCGGCAATCTGTCGCACGAGTTCCATGTGCTGGCAGATGTCGGTGAAGACGCGATTTTATCCTGTTCATCGTTGCA
GTGTGAATACGCGGCGAATGTGGAGAAGGCAGAGGGACTTTTGCCGACATCGAATGAAGCACCGATGGAGCACGGTGACGAAGTATCGGCTGAGCTATGC
GCCATCATTGCGCGGCTCAACGATCAAGCTCGTGCAGGTGACGAACAGGTGTGGAAAACTGTCTTAGAGCTTCAGGAATCAGCTGGGTCGCAGGGGTTCT
CGGTCAAATGCgtgcacgagcaggaggaagcCTATGatcttgacgctgctgagaAGGACGACGTTGAGGACAGTGCACCACCTCGTATAGCGTTGTGCTT
TACTCGACAAGACCGTGAGGTGAATGAACTGGCAGCGAAGCCGTTCATTGGcggcgatgaaggcgaagtgATTAAGCACCAGGCAAAGAtcgttgagctg
cttgcgaAACGTGATCCGACCGCAGAGCTTCATTTGCTTCTGGATGATTCGCTGAAACAAGGAGAGCACGCTTCACCAGCTGTGGAGGCTCTTTGCGCCG
CTGCAGAGACCCtatcgaagcagcaggagcacaCTGATCTGGCGTGGGGACACTTCCGTTTGGCTCAAGCTGGCGACTGCTGCCCGCGCTGCAAAGGTCA
CAACGCAGTGCTTGAGGACAAGCGCGGTATCGAAGTGGGTCATGTTTTCTACCTCGGACAGAAATACTCAAAGCCATTCGGCGCAACGTACACAGACGCC
AAAAACAACAAGCACCCGCTAGAAATGGGCTGCTACGGTCTTGGTGTTAGCCGACtggttgcagcagcagtcgaggCCTCGCACGACGACCACGGTATCG
CGTGGCCCACCGCGATTGCGCCGTACAAGGTTCTCGTCATGTCCATtggcggcaagaagcagggCGATCCCGTATCCCAAGCTGCATGGAGTATTGCTGG
CAAGCTTGCTTCTGGCAAGGTGGCAGGCCTGGTGAAagacgacgtgctgcttgacgacCGCTGGCGAGAGAGCCCGGGCTCCAAGCTCGCCGAGTCGGAG
CTTATTGGCTACCCGTACCGTGTCGTCGTGGGCAAGCGGTTCACGAAGGAAGGTCTCGTCGAGGTGCAGACGCGAGCTACGATGGAAAAGACGTTCCTTA
CGCCGGAGGAGCTACCGGCGTTCTTCGCTGACATGTGAGTGAGTCTGATAATTTCTAATAGACGGTCTCAGATT