Description :
From Genome Similarity Track
Location :
Scaffold_26:607395- 610308
Transcript NameFunction/comments
Phyca_LT1534114308conserved unknown protein
Phyca_LT1534567786Hypothetical protein
Phyca_LT1534114401Hypothetical protein

Sequence
2913 bases(100 bases per row)
cggttgttgccttcccattttactcgcttgagcacgtggtttctcagattgaggccatttacgacgacaagtttgtatctgatcgggctgatgaagcgga
cggggcagctcgtgaagaactggtaagtacaatttggaaataaattgctggaactatcttaatgtcttggcattagcctcgtttcatttgtgaatatttt
ctaaagacacatggactacgacagagcgcagaggtgggcttataccgtttcctggtgtccgtcaagaacacgtaccagaaaaactcgcatgttcgactgt
ttacgcgtctatcaaacttactaaagagttctgatgaggattcggagccaagtccaccagttagctcaacaagcaagaaaagtccgagcaaaggtccaga
aacagaagctgagtctgatctaaagcgtgtgaagcgctctaaatatttggatcgcagcttcctacacgttttcttggaggctcgacactatttactgcgt
ccaccaccacatgaagcaccaaaagctaagaaatctcacaaaagaggaagtgaaactggagcaagtacgaaggtggaagcttttgagcatgttatccaag
tagaaccgacgaagacgtgggttccacttgaccatgcgatcacagtattgcggtggtatattagctgtctgccagaggatagtatctcctcgtattgtcg
gcaggtatgtaaagtaaactcgtgatttatcccttctaactattgctgtttgactgctttcaggttgaacacagtacagccatttacgacggacggacga
tcactgagattgcaggcaatcggttggctgtacgcgctgaaatgagacgagtgatgctggttaatgagaatccagagacattatctacagcagaaatcac
caagcggccatcacctcgcgttgttgcagatgtacataaagtattgaagctactgatggatgcgcttgaacagcgacgcgaagggattaagaacgatctc
actgcactctttgatgcagtaagtgctgaacatcaggattcttttttattattttgctgacgagtgttcccttgccaacagggtgatacgaatcacgact
gcgttttgactctggatgagtttagtgctatcattcgcaagcgaaaaccccatttcagcgatcgtcgcatcctgcgaatgttccgtgaagctttaatggg
aggaacagagcagtcctttgctctttcaatggatgcatttgtggtagtttgcaatgaccacggattggtttcgttacttccggacgatcgaatggtggac
cctttcgctctacctcagacaaaaccagaaaccagtcggcagggtaaagcgccattgcaaaaccccgacacaacgactaatgaggacaaggcgtctgctg
ctttgttggattctgaagaccgaaatgtgaaatctgacactgggtagctgaataatgctggaaacgtactgcactacttctttacttctgagctatcgtc
ttgtgttgcggcgttgctttctggcactggcacaacttcagcggctgaagaagttggcgttctgtcacctccaacatgatggcggtgtttggttcggttg
gcttgaatgcgttgcatactgacgacagtcgctactttggctatgagattgaggatcaacatgaacaaagcgaactggttcgtactgcagccggggaaat
gatcggacgcgccgccacagctgacgatagacacggcacttgagttgcagaattggtcgaagaacacacgcccggagacccacaaacccatccagataac
gtctgtcaccaccgagaaactgatcgcgagcatgtgcagcggcacaagacgcgagtacttggcgctccaggacggagtattcacaagtaacccccacaag
gccaatgcgaagttgtacgctggaaacgccacgtacgaaagctgcatcaatagactgcacccgagctggatttgagccagacgaccaacaattctccacc
atttctgctcaggagtaagtactgctagcggggcatcacgggggcttttcttcttcaaacgacgagtaagtcgcgagctcgtacttggcattgttgagta
gtcttgaagtgcccagtccagtagttgctaaaaaatagtcttgaaacctctaattttgccgaagttttgctgtgctcaaactctcgatgtactcgacgta
ctgagtcgaactgtcggcaagctgggagctctgcaacttgcaccaatagtccaacaccaacgcgtctaaatacacgagttgttgtgctgaaacaccgcct
tctccatcggaagcgccttgtacatgttctgaaatgggtcgatcgtgattcgttccagcagacactacagcattttgacaaacagcggcaaaactcacag
aattgccttcacctcgttcgcggatctttgcttctgggtctaaaccacgagctttcatccacaaagttactgcagtacctttgtcgttcttcctccacag
taacaggaccaaattaaacttgatggcgagacaatcaggatactgttgcagtcctttgcgtaagattgagatagcggcatcaggtccatagcagcaaacc
acaactacagcaacattgttcatcaattgaacgtgacacgacgcaatttcttcagtcacttgagattcttgtgccatcgcgtgttgaatctttggctcga
caacctggttgagatacgctaagcattcctcgacgcgctccaaacacagcaaggcatccgctttgtatagatggagtagtaggagtgctattttgtcgcg
atactccgtgtattccagcaaatattgctcgcatttactgaacgccaacgacggcagcttgcactggaagtcaatcgacacaatgttaaccagttatcaa
caacgaatcaata