Description :
From Genome Similarity Track
Location :
Scaffold_18:60738- 64782
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_18-snap-gene-0.50RAB6 interacting protein 1
Pytve_DAOMBR484maker-pve_contig_18-fgenesh-gene-0.30Ran-binding protein (RanBP10)

Sequence
4044 bases(100 bases per row)
TCGGACACATTGAACTCGTTGTACCCAAAGAGCAAGATCCGGAGAACTCGAAAGTCCAGCAACGTCAATGCCTACAACATCTCTTCGCCGACCGCAGCCG
GAAGTTTGTCGTTTGCTAGCTCCTCGAGTTCAGCTTCGTTTCTGCAAGGAACAGCGGCGACCATTGTCGACGATGGGAGCGAAGGGTTAGCGGACAGTCG
GTACAACGAAGTGGACGGGTTCTCGACGCAAGGGATACGAAAGGCATTTCTACGGTTCTTTGTCACGATCTTGAAGAAGTACTCGCAGTATCTGGTACGA
GAACAGGTATTGCCAATTTTGATGCGGTGATTGCCATATGCTGACATTGGGAACGGTTGTTGTCGTGCGTGCAGAAGACACCGACTTCGGCGCAATCCAA
GGAGCGAATTGGATCCCTGTTCGACGGCGAGGCATTTTTGCGAGATAATCACGATCCAGCAGCGAAGCCGTTCATTGCACAGCTGCTCATGACGCAAATG
TTTGATCGCTTCATCGAGGATCGCGTGATGAATGCCCACCTACCGGAAGTGCTGTTTTTCGATCAGTCGATCAACCAGAAGCTCAATCGGTCGATGAACA
TCTCGAAAAAGAAGTACGACTGCAGCTTTCTGGACGATCGCTCTGATGATGTCAAAGTTACATTCATCGCCCCACCACCATCCAATATCGGCCTCCCTGA
CAATGGGACAGTCTACAGCGTACGCGCTCAGTTCGTTGTGCAGATGAACATGCCGCATGAACTAACTAACCTGTTGCAATTGCTGTTCCAGTACAAGGCG
TTTCCACGACTCAAAAAGTGCGTTTCCACACTTTTTGCTGATCCGGACGAATTGTAGCTGACGAATGACTGTGTGTGTGCGTCCGTCGCAGAGCGCTGTA
TGGCAATGTGCGCAAGCCCAGAGAACTATTTTCTTCGCGCGAGCAGCAACGCAACGTGTCTCAAGTCGACCTGAACCATCGTCTCTTCACGATAGCCAAG
TACGTTCTGATCACAAGTGCTGGGGTTATGCTGTGTTGACGAGCTGGTTCTGTTTGGTCAGACGCACGAACGGAAGCAACCCAAGCTGGGAGACTACGCG
TCGACTGATTGTCCATGTACGTAAAGTGCTCGCTTGCCACAGTTATTGATTGCATCGTTTGATTAACAACAACTGTGTGTCGAGTAGCTACAAACGCAGT
ACCGAATGTACAGCGCTCGCAAACGATTCCTCTCGAAGAAGCGAGCAGCCATTTCCTTACAACGATGGATCCTGGCAAGAATGAAGGCAAGTGGTGTATC
GTGTCACATTCGACTCTCTTTGCGTCATGATCTCATCACATTCCGTGTTTGTGTACTGCAGGGTCGCATGGACCGCCAACAATTTTTACAATTGCGTCAT
GGAGCTATTATGTTCCAGTCCGCTTTTCGAATGCACCGCCTGTACAAGCTGTATGCTGTCAAGTGTGCAGCGCTGCGCAGACTACAGGTATGGAGATGGC
TTCATATGATGTATGTATCCACGTCGGAAGAACAGTGCTCTGACAGCGCATCAAGTTTGTCGCAAGGGGATATGTTCTGCGATTGCGGTACCAGCGCGCC
ATTCGAGGGTTCCGCCGGTTACAGGCGCAATGGCGCAGCAGATTGCACACGCTGAGCTACAACAGTTTAAAGCTGCGGGTGATTCGGCTTCAGAGCCGCG
TCCGAGGCCATCTTTGCCGCCAGCGAACCAAGAGGTTGATCTTGCTGGCTGGATGCGTGAGAATCCTGGTAGTCGCAACATCTGACCCGTTTGCTGTGCT
GCTGGTGCTAATAGATGGCAAGACGCAATGTTCAAAAGCAAACGCGTCGAAATCTACAATCTGTGGGGGAAGTGCGGCGTCCCTTTGATGCACAGATCGA
AGTTTTGGCTGACCTTCGACAGTCCCGACTTTTTCAACCTCGGAGTGCGCTGTGCTTGAGTCGATTTCGTCCTGGTGCGAAACACTGACAATTTTGTCAT
GGTCTGCTGACTGCTGCAGATCTATTTGGAAGAGGAGAATCGACTGAAGGCTTCCATCAACGATTCCCAGACTCTTCAAGATGGGGACGGGAATCCTCTA
CCGACTCCAGTGTCTGCGAGAAAGGCGACGGAGCTCCGAAAACCTGCTTTACCTTTCATGAAAGGCTTGGTGCGGCAAAAGGCGGGCGACGATCGCCGAA
CCATTGGTGATATCGTATGTTCACAGTGTCTCGATAGTAGATCCGGACCGGAACAGTGGCGCTGAGATATGGCAATCGTTTTGACAATGGCTCCAGGCGC
TCTTACAGATAGAAGAAGAGCGAGTTCAGATCTACCATGCGCTAAAGAAACACACAAGCGCATCTGCTCGACTTGCATTCTACGCTCAATTCAGCATCGA
CCCGTCCAGCAAGAAGAAGAAGAGAAGGGTAAGCCTCATCGATCGAGTTATCGTTCATGGTTCGACGAATGACACACTACTCACTACGGTACTCCTCTAG
TTGTCACAAGCGGTCTGGTCGAAATACGAATATGCGAGCATCAGCGCGGAGGTACGCTGGCCACTGACCCGTCCACCCACGCAATGAGTTCATGCATCGG
CTAACCCGTTCGTTGTGAATACGTTGATGGCGCGTCAGGTTGTTGTGACTCTGACAGCTTCGTCCGAGCGAGTTCAAAACTTACCCGCCCAGATTGATCG
TCACAAGCAGGTCGGTGACATGTTGATACGTTGTGCATCGAGATGCAGCTCTGACTCGGCACATTTGCTCGTCTGTTGTTGAGCAGCTGCGGATTCGAGA
AGACCTAGCGTTCACAGTCAACGCAGCACTCGGGTCAATGTACCGCTCATCGGCGAAGACTGCCAAGTCGTTGTCATCACCACGACCACCGCATCATCAA
CGCGAGCTTGCCGAGAACCAGCGCCAAATCAAGGTGTTGATAGCACAAAATCGGCGACTAACGGATGAGCTCGCCGACGCTCAGAAGGAAATGAGCCGCC
TCCAGAGAGAGCTTCAGCTCGCGCGGCAATCTCGCGAGGAAGCATCCGCGGACGAGAGCGCGGCGAAATAACGATGCCGTATTTGATCAGAGAGGCATGG
AATTCACAGACAACTCACGAATGAAGTGAAGTCCGGTGTTTTCCAAATACTGTTAGTTGTGTCTAATTAGCTGCGGCGACACTAGCTCTATTTATTTCGC
CGCCACTGCCCAGCAGGACGGCGTGGCGCTCGAACATTCGCAGGACGAATGACCACAGCGGCTCCTCGGTCTCGTTCCAGCCCTCTTCCTGTGCGGATAT
GTACGACTCTTCGTCATTGTTGCTGTCTTGGATCGTGTGCCAGCCCAAATCCTTCCAAGCCAAAGTCTTGGAGCCGGAGCACTCTCCCAGGAACTCGTCT
GCGGTTCAGACATTCAGGGTTAGCAGAGCGTCAAGACCACCTAGATACGATTCGAGCTCACCGATGGCGCAGTCGTATCGGAATGGCTGCTGTCCGAAGT
TGGCGCGAACAACGTCGTACGAGTCGATCCCGATCGCCGGGAACCACCCTCGCTCGTCGCGCCATTCGACACATTCGTGACGGGACTGCTGTTCATCTGG
ATGGAAACACAAAGCACGATCAGGTCAGTTGATATCCAGATTCGACGGGATGCTTTGGCGACATACTGATCATTTTGCCGTTCTTGGTGAAGAAGACGTT
CATTCGGCTACCGTGCATGTTATTACGTAGTCCACAGCCGACCGTGTCGCCAGCTGAGAACCGCGGACCGAATGGTGTGCCCTGCGAGAACAGGCGTCGC
AAAAACAATCGTCAATCAGTGATCAGGTAGCAGAACAATGCACAACCACTGGCGAACGTACACCAAGTTCGCCCGACTTGCGGAACAACCGACCATCGTC
GCCGTGGTAACCATACGACCGCCCGCGCCACCCGGGCTGTCGACCCACGAGCGGGAATCGGTCGGACACAAGCCCGATGGCCACAACGTCGTCGCCACGC
ACGCGCTCAGCGTCCACATGGCGATGCTCGGGCTCCGAGACGCT