Description :
From Genome Similarity Track
Location :
Scaffold_91:60729- 63313
Transcript NameFunction/comments
Phypl_g2885hypothetical protein
Phypl_g2886reverse transcriptase

Sequence
2584 bases(100 bases per row)
ttTTGGGTGAGCTTCAAGTCCTCCTGGCGTCACTCGATGCCCTAGATAATCCACTTTGTTCAATCCCCAATAGCTCTTTACCACACTGATGGACAAATTC
CACTCATCACATGCATCCAGCAGATCCTCCACCCGATCACATAGTTGATCCCATGATCCGGCAGTCACCGGGATGTCATCGATATATGATCTGCGCCCCA
GTACTGATGGTTTACCTGGATCAACGGGTTCTCCTGCTGCGAACAAGTCAGTCAGCTGGCCCCGGTCGCCTGATCGGAAGGTCTTCATGAACCCATACAA
CGCGTTGTCCACCAGTTGCTGGAACATCtgcggcgccttcttgagaCCAAACGACATCCGGTTCCACTCGAACAGTCCAAAGGGAGTGATGAATGCTGAG
ATCGCTCGAACTCGGTCCGTCATCGTGACCACCCAGAAGTCGCTAGCCATATCCAGCGAACAATACCATAATACCTAGTCCAGGTCTTCCAACAGATCGT
TGATCAGCCGCGTAAGTCCGTTCACCAGTCGATAGTCAATGCACAGTCGGATATCCACTCTGTTCTTCTTGATAGTGATCACGATCGGCGATGCCCAGGG
CGACGTCGAGTGTCTAACGATCTTAGTCGTCAAGAGTCCCTTGAGCAGTTCTAACACCTTCTCTCGGAACTGAGGGGTAATCTTCCGCACCCGTTGCGCG
ATAGACCTTGCCCCACCTATGTCGATATCACATACAACGCCCCTGGCGGCAAGGGCAACGCATTGCCCTTGCCGATCAGGAGGTGTCGTCTCTTCCAGAC
CGTCCGACGTAGCCGATCGATCTCCTCAGGGGTATTACGCTTCGGATCTCCCACCTTATTATCTTCGATCGTCATTTCGTCTGTCGTGTAGACGCTAAGA
TCCGGAAGCACAGACAGCTCTCTTTCGACACTTCGGCCAATAAGTCACTTCCTTTGTGATAGAAGCtcgctccatctcctcccTTCCGACATTCGCTTAA
TCAGGTCGATCCTCTCGTACAGTGTGATCATGAATCGAGCCGAGACTCGGATCTGTCACGTCGGTACCCCCTCGCGGTCTGCCGGAGTCATGATCTTGAA
CAGACGAAGGCGGATTTGCTTCCAACGGCGAGACAGCCCTTTCGTCTTCTGATGTCGACTCCagccgtccttcttgactCGTCTCTGCTTCGATCTCTTC
TACAAGATCTCCCATCGATCTGTCCGGATGAGCATCGGTGGCCGATCGGGCGTCATCTTCTTGACTACGGGTCAAGTTGATCGACATCACACGTGGGGAT
TCCGACGTCTTCTCTGCTTAGGATCGGGCATCGTGATATACAATTGATCATCGAGATCGGCCGGAGCGGCGGATCCATACTCAGCCTTGACCGTTCGACC
TCTTCGCATTATCGCCCGCGGTATGGGATATACCGGGTGCCCACCGCAGGTCCTGGATCAGGTAGGTCTGCCTCCGGAGGAACGGCCTCCACCATCGCTT
GGAAGGCCAGATTCTGACATTCATTATAGCGACGTGTCCCGATCGAGACGAACCCTGGTAAACGGGGAACCCGACCTCCGGCTAGCCATATTGCGACCCG
TACATCCTGTTGGAGAATGAACCGGCTATCGCTGATATTAGTGATCCGCAGGTATCTGCGTCGTCCGGGTCCTCCAGCCGCGGTTGGTACCCAGCGATCT
CCGCGGGTAACCCATAACTTCTCTCGATCGGAAAACGCACGTAGACGTATAGGCAGCTCGCAACTCCCCGACCTCGATCTGGAGATGTTAATCTATCGTC
ACCAACTTGACTCGGTCATAGTTAAGCTGCCGTCGACCACTGAGCTGGATCTCGATCTCATCTGGTAGGCAGATTGATCCATCAGCCCGATCGAGTATGA
TCCCAGCGGGGACGATGAAGTCCATCCCCAGAATCGCATCTTGACGTGACAGTTCACCCACCCAGATATAAAAAAAAGTAGACCAGCGATCCCCCCAGGG
TGATCTTGATCCGCGTCCTTCCTTCCGTGACATACACGTTCTCACCGATCCCGACACACTCCTGACTCTGACTCCTATTGATATGGCACCCAATCTTACG
AGTAAAGGCGGTATCCACGATGGACACCTCGGCACCAGTATCTAAGAGTAAGACCGCCTTGTCATTGTTGATCTTGCCTGTCATCTTCGCCTGTCGAAAC
CACTTTCATGATGTTTCCAGTAGCTTCGGGACTCTTCTGGTAGGAGATCCAAGGGCATCGTGACGTCCGATCGGCGATATTCATCGACCTGGCAGAGGTT
TGACATCACAGCAGTTCGTTTCCCATGTATATCACATGTATTATCGCGTAGACCTTGTTGGTGATCGCTGACTTGATCTACCGATCCCTTGTCCACAAAT
GCTTAAATGCAGAACCTACAATGCTCGGCTCGTATCGGGTTCCAACCCGACGAGCGTCCTAGTTTAACATCTTCTCAGCCATCGCAGGCATCATGCCCGC
ATGCTTGGTAGGGTTATACCACTGACGGATCTGGTTGTAGCATTCTTCCATCGGGCACTTCCCAATGTCGTGAAGCTCTCCACA