Description :
From Genome Similarity Track
Location :
scaffold_97:60723- 62572
Transcript NameFunction/comments
Pl_109850hypothetical protein PHYSODRAFT_360938

Sequence
1849 bases(100 bases per row)
GTCTTACCCACCTGGTATGGAGGGTGTTTCGCATCCGTATTGACGTCAAGCATTGTCGCCAACTTTTCCACCATTTGAGCTGCCACTTCTTTCTCAACCT
GCCCCTGTGCAGTTGGTACCTGCGACAAGATGCAGCTGTACGTTTTGATAAATACATCGTGAGGAAAACGCACAGGGTAGCCGCTGCGAGAAATCTTGAC
TGCTTCCAACACACCACTGCAGCGCAACTGTTCCAGGAGACGTCTTCGGTCGAACTGCGACGCACTCGCTTGATCGTTTGGCTTAATGCAACGAATAAAG
TGGGGTTCTGTTGCATTTAACACATCCAGAAGCGAGCTCAGCTGACTCTTAAACTGTGCAACAACCGTAGATGACATAATACCGCCAGATCGACGACGAT
TGCCATCGCTACCACGAGACTCGGTCCGTCCGTTCCTTGGACTAGCACTACCACCGTTGACACTGTTTTCGAAACAAGCACGCACAAAAGAGAATTTGGA
CGTGCGCAGCAGATCTACCGCTTCAGTGTGCATGTGGTCCTTATTCTTGTCGCAAAAACCATCAGTCATATAACACACATCGCCGGCATAGTGGTGAATC
ACAAATTGTCCCTTCGCTCGCTGAAGCTTGGTCACCGAGAAACTCTCGTGTTTGCCTGCTAGCAACTCGTAGTACTTGTTCGCAAGTTTTTCGTCATTAC
CGCGCGGGATAAGACACTGTTCATCAAGCAGAGAAAAAATACCCATGTGGCGCTTTTCCACCAACGCCACGCACACATCGTTATTTGGGTAGTCCACAAA
CTTCCAAGGAATTTCTTCCGCAACATACTGATCCTGCTCCATCCGGAACACGAATCTGCCAAATAACTGTTGCAACTTCTCATTGGCAAAGTTGATACAC
AACTGCTCTAGACGGTTTTGCTCAAAAATTTCGAAGCCAAAAATGTCAACCACGCCAATGAACTGACTGCCACCAGCTTCTTCCTTGTACTCAATACTCC
GGTTAATGCGATCCACCAGCCAGTTAAACAGGTTCGAGTAAAGCGTCTTGACCACAGAGTCACGTGTTGAGAGTGCTTGTGTAACTGGAAGACGAGTCGT
GATGAACTCCGCGCCAGCTTTGATTTGCTTTGTACAAAGCGTATTGCGTAACACGTCTTCTTCTACGCCAAGAAGCGCGCAAATGGCTTGAATGTTATCA
CTGCATTCATCCATGTCTACAACAGATGCATCATCCTTTCCACCATTGCGCGTAGCTGTCGTAAAACAAACGTTACCGAAGTGTAGTACAGCAGAGACAA
TTTTCATCACATTCAGCTGCTCATCAGGACTCATACCAATGCTTGACATGGCTCTTCGCGTCACGTGATAGGAATCAGCATCATTCACTCCGTCTAGACG
TTCGTAACACTCGGACTGATTTAAATACGCGTACTCATGCAGGTCACGCAGCGCCAGTTCCTGTCGCTCTGATGGGGAGCTGCCGCCACACATCTCGTAG
AAAATATGGTAATTGCGTTCACCCTTGCCCTGTGACACGAGGCGTACGCGTTCCAACAGGTATGTAGAAATCGAAGCACCCAGCATTTCACCTGAGGACG
TAAAACCCAGCTTGATGAACTTACCGAAGCGACTAGAATTGTTATTCCTCGTGGTCCTTGCATTACCGAACGCCTCCAAAATCGGGTTCGACTCCAACAC
TCGGTCATGAATTGTCGTTTGGTCGCAGTTGCTAGATCGAATTGGGCGACGAGTACGCTTCGTCGACACGTATGCCAAGTAGTTCATGATGAGCTTCGTG
GTTTCCGTCTTACCAGCACCACTCTCACCGCTCACCAGAATGGTCTGAT