Description :
From Genome Similarity Track
Location :
scaffold_7:6072- 42472
Transcript NameFunction/comments
Pl_112688conserved hypothetical protein
Pl_112689ATP-binding Cassette (ABC) Superfamily
Pl_112690hypothetical protein PHYSODRAFT_505814
Pl_112691glucan 1,3-beta-glucosidase, putative
Pl_112692hypothetical protein PHYSODRAFT_508027
Pl_112693tryptophan synthase
Pl_112694hypothetical protein PHYSODRAFT_505149
Pl_112695DNA repair and recombination protein RAD54
Pl_112696conserved hypothetical protein
Pl_112697sialin-like protein
Pl_112698kinesin-like protein
Pl_112699DEAD/DEAH box RNA helicase, putative
Pl_112700hypothetical protein PHYSODRAFT_560612
Pl_112701hypothetical protein PHYSODRAFT_354854
Pl_112702peptidyl-prolyl cis-trans isomerase, mitochondrial precursor

Sequence
36400 bases(100 bases per row)
TATTAAATAGAATTTACATTATGAATACAGCTTGGACGTTCAAACGTCTACATCATCTTCATGGTTGCTTGGATGGTACTGCGTATCGGAGAAATCGGGC
GATGACACAACCATAGGAAACTCTGGTGGTTGGAAGCCGAAATGGGGCAGCGGCTCAATACCAGGTCCAAATGGCATCGGTGGACAGGGGTTGAAGTAGT
ATCGCGATAATGCTGCAGGTGGCAGGAAATGTGGCGCATGGAATCTCGAGTACGCATCGCCATTGCCAGGCGAAAAGTATCGCACCACTTCTTTGGGCGC
TGTTCTCCACAGAGTCGATTCGTTCCATGGAAGGTTGGCACCGGGGTCTGGCAGCTCGCACTGCCGCGAAAAGTCCCAGCCGAAGAGAGACGACGTTGAC
GCGTACACTTGCTGCAATTGCCACTCCAGCTCTGCATTCTCCTCACGTCGACGTTGTTTCCTTCTCCACCGCTGCTGTACACCTCTCTCGTCAAATTCAT
CTTCTCTATCTGACAAATCTCCACCACTGCTTCGGGTTTCAAAGGCACTACTCGCGTCACTCTCGACATCCCCCCACGGGACGCTGACAATGTACTCGTC
AAACTTCCGCTTGCCTGCAAATGGGTTTCTTATGCCCACATCTTCGATTGCCAATATATGCTCCTGGGGAAGGAATACGAGAGCATTGGGATTCAGACCC
GACGACTTTTTCGATGAGGTTTCCGCTTCTGCAGGCATAGCTTCATCAGTGTCCAGCATGCCTTCATCAGTTTGTGCTGTCGATGAATTTGACTGACAAT
CGCTGTCTAGAGGAACCGGTTTGGGCTCAGGTATTGGTTCTGGTGTTGGCTCCTCGCCGTTCGGTGATTCATGATCCAAGAGCATGATATCACAATTATC
CGCTTTAGGATCATCCTTGAGCTCATTTTTGATAATCTCGGACTTTACAACTTGTTGTACAGTTGCAGCAGTATGTGCTGCCGATTTCTTTTTCTTCTTT
TTTTTCTTGCTTTTCTTCCTGCTGTGAGAAGCTGGGTTATCTGTTGACTGTCCTGTATCCTCAAGTGACACTTCCAGCAGTAGTTGCTCCATTTGTTGCG
CCGCCTCTTTCTCTAAGTGACTAACGTAACTTCGTAAAATAAGCTAAGTCACCGCACAAACCATTAGATTAGCCTGACAATCACAACATTTGAATCGATA
AATTTACCTGCTCTACCAACATCGCAATCAAACGCTGGTAGTTCGCCCATGTGTTAATGGTTTCACTCTCCGTCACAAAGAGTTTGTTGAAGTTGCTCTC
CGTGAGGACGTGGATCGAAGTCAGAAACCCCGTTAACACATCTCCTACCAGCGTGAACAATCGATTGGTATCTTCAGCCAGCTCCGTTTTCACCGTCAGA
ATACCTGCAATGTACCAAATAGCGTGAGCAAAACGCTATAGACTATCATTTACATACTCAAGCACCAGTATACCTGTGCCTATATCCATGAATTCCATTG
CTTCTAGAAGCTCGTACGTCTTCTCCGACGAGGTGTCTGTTACTGCACGTGTCACCGGCTGTGCTGTTGCTCGCTCTTGCACTACTGACACATTAGTAGA
GTTTGCAACCTTTGACACTATCGGCGATGATGCCGCTACCTTTTTATTGGCGGCTGTTACGTCTGTAGTTGTTCGATTTGACGTCTTGAGATGTCGTTGC
ATTAGCCCAACACACAGCAAGCTCAGATTGAGCTTGTATAGTTGTTTCACGAGCTCCGGTTCGTCCAAGAACAGTATTTGCTGTCGCTCATTCACACTGA
GCTGCTCCCAATAATGGCGGATACTTTTCAGCACAGCAGCGCCATCCTCACCGCTGCGAGTCGTCGTTAAGGGCGTGGCCAACGTCAACCAAGTGCCAGC
CCCTTGTCCATGGGCTCCTCTAATAGCCAGTGACTTTGCTCTCTTTCGACCACATGAGTTTGCATTAATACTGCTTTTATTCACTTGATCCATTGCAACA
CCAGCGCTCAAAGGACGAATGGTCAGGTACGATTTCCAGATTGGCGCTACATTGAAGCGACCATAGCACGGAATGTACCAATTAGCACTGCAATTCATGT
GCATCAATTAAGTCATCGTGGCCACGCACCTTCGGTGGTCGAAGCTGCCTTCTTCACGGAGGAAACGCCTCCTCGAGATACAGACGCCATGACGGTCTCC
TATCGAATTGATCCTTGGCCACCAAAGTTAGAATGTTTTGTGTTTTATTATAGATTATTGTGTTTTATACTTTTTGAAAATGCATGTTTGCTTTTCAGAC
ATTGCATCTGAGATGGCGGACATCCAACACAAGCGCGTGGCGCTCAAGCTTAAGCAGGCGTGCGAGGAGACAGCAGCACAGGCGATCGCAGCTACCACCG
CCAGTGGACAGGCAAGTCGCATCCACGGTAAAAACCGCAAGTTCGGCAGTCGCAAAGAGGCCATGGCAGCCAAGGCAAGACGGCAGAGATGCTGATAACA
TATACTTATGAAGTAATTGTCATTGATTTCCTATTGTCTATGCAGATTACAGCAGCCAAAGCGAAGCGAGAAGCGAAAGAAGCAGCAGATAAGTGAGATC
GAAGTAAAGTGATTGCCACTAGGAATAGGCAGAGCGTCCGTTTTTCATTCCGTTTCGTTGCTTTCACCTCTACCAAATACATTGTGAAGAACATTTCCGA
CTTAGTCACTCGCACTTCTACAGCAATCTTTGTTGTCTATCTGCCCAGTGACAACTGATGAAGGCTGAACGGAGAATATTCCTAGTGCTACGAGCTCTCG
TGATCAAGAACTGGACGGTCAAAAGAAGACGTCCATTTGCAACGTTGAGTGAAATTCTCAATCCGTTGCTCTTCATTTTGTTGTTTGTAGCGCTGAAGAG
GTTTGAGCCGGACTTGATCATTCCAGCTGGATGGGCTACCAGTGACGCTAATAGCTCTGCTCCTGGGTATGGGTCTACTTGGAATTTATATGATACAACG
GATGTTAATTCGTTGTTGAACGAAGGCTTGAGCAACGTGGGTATTATTGTACCGGAGGATTCGTCGAGTGCGAGTAGCAGCACCAATTCGTCAAATGGAG
CAATATCTGCTAGCTCGCTGCTAGAGAAAGTGAGCAGTAGTCTACGGATTCCCAAGTTCTATTTCACTGAAACGACGATGCCGGGGTTGTTATTGAGTCT
GTCACTTCAGGCCCTAATGGCAGGCGACAAACTCGATGAATTGGGAGAAGACGCGCTGATGGAGTGTGTACTAAAGTTCCTGTTATTTGGCTATACTGGA
GCGAAGGGCACTAGCTACCACGTTCCCAATGCGTGCAAGGAGAAAGTTGTGCCGTACAAAATCGCTATCACCCCAGATACGCCATACACACGAGAGTATT
TTGCAGCAACATTAGGAGAGTGGTACCCACGCATTGACCTTGCACCATCCGTGAAAGGAATATCGTTGCTGACAATTCCGAGCTTCGCTGATTCGCACGT
ATTCTTCGATAATGAGACGGCTTTGGAGACGTACGTGTCCAGTAAAGAATATGGCACCAATGTTCAGCACCCAAGGATTTATGGAGCCATTGTTTTTGAC
GAGTTTCCGGAAGATGTGACTACCATTGGTGATTTGGATGGCCATTCGATTGTATATTCTCTACGATTTAACTCGACTGGAAGTCAATCAGCAGTGCCGA
AGACGAAGAAGCCAAGACTTAACAATATTTCAAAGTTTGCATTAGCGGAAAATATCATGAGCTATTCAACGCATGGCTTCATGACGCTGCAGACACTGGT
GGCACGTTTTCTAAATTGCATGCCTGTGTGGGATGCGCACATGGAGACAACCAATGGAACATGTCAAATCCACCAGGCTGTCATGCTTGCAAATGCAGAA
AACGATCGTCGACTGCTAGGACAAGTCGAAAAAGACATAATCATTGGTACCGCCTTCGAATTGTTAAACTCGGTCAAGGACTTGATCACCAATACTGTCT
CGGTGAGCCTTCCGAATATTTCTGTGGATACCATTCCACCCCTGAGTGTGGAAACACTGCTAGTACCTTTGCGAATAGCACCTCAGTCATATCATGGTGC
CGGTGTGTATGGAATCCCTACCCAGGCTTTTCATTACGCCCCATTTTTTGACAAGGTGGCCCTGGTATTCCCCATTGGTTTCATTTTATCTTATCTGTAT
CTCGTGTCACGCATTATTGTGTCGTTTCTCATGGAAAAGGAAGCGAAGTCTCGAGAGCTCATGCGGATTCTTGGAGCACGCGATAGTGAACTATTTGCTG
GTTGGGTGTTAGCATACCTGCCGATCTTACTGCTTGGGACGTTATTACAAACTTTGGGTGCGCATGGACTGTTGTTTCCCAACTCGGATACGAAGTTGCT
GTTCGTATTTTTCTTCTCTTTTGCTACCAGCAGCTTCAGCTACGGCTTCATGATTAGCAGCCTCTTCTCTAGAGCACGCGCGGGATCACTAGCTGGCATG
GGTCTGTTTTTCATTATGTTTTTCTTGTCCTACAGTTTCAGCGACGACACCGACGAAGCCAGTCGAACATGTGCAGGGCTACTCCCACCCATTTCATTAT
CACAAGGTATTGGTGTGATAGCCAAGCTTGAGTCCTTTGGAGTTGGAGTGAACAGTGGTAATGTCGATAAAGAGGTTAATAACTTCCGATTTTCAAATGC
TGTTGGAATCCAGGTTTTAGACACGGTGCTCTACTTTGTACTTGGGAAATATTTCGAGAAAGTGGTTCCACAAGAATTTGGCGTGACGGAGAAATGGTAT
TTTTTCTTGACGAAAGCTTATTGGTGCCCACAGGCCTCGAAACTAGTATCTGCAGAAGAGCAAGGGAATAGTGGACTGGGTGAAACAGCGACGAACAATG
ACACTGTGGAAAATATTCGACAAGATCTGGAGATGCAAGAAAATAGTGGTCGTGCAGTGATTATCGCTGGTTTGCGAAAGGAGTTTTCAGTTCCTGGAGG
GAAGAAAGTAGCAGTGCATGGGCTGCATTTGAAGCTATACGAAGGTCAGGTCACATGTTTGCTTGGTCACAACGGAGCAGGGAAAACGACTGTTATGTCT
ATGCTTACCGGAATGACGCGGCCATCCAACGGAAATGCTTGGGTTCGAGGTCATTCTGTCGTCACCGATATGCGGAAAATCCGTCAGTCGCTTGGTTATT
GCCCTCAACACAGCGTGCTTTACCCAGATCTAACCGTAAAGGAGCACCTCATGTTTTATGGGCGTCTTAAGGGTTATGCGGATGCCAGCGAGCTTGCAGC
AGAAGTTTCAATGAAGATTAATGAAGTGGGTTTGGAAGATAAAACCAACGTTCGATCACATGCTCTGTCAGGCGGAATGCAGCGAAAGCTTTCGCTTTCT
ATTGCATTCCTGGGTGATAGTACGGTTGTTTTCCTGGATGAACCGACAGCAGGCATGGATCCGTACAGTCGTCGCAGTATTTGGGAGCTTATACAGCGTA
ATCGCGTTGGACGCGTGGTAATCTTGTCGACGCATTTCATGGATGAAGCGGACATATTAGGTGACCGGATCGCCATAATGGCAGAAGGAAAATTGCAATG
CGCGGGCTCCTCATTGTTTTTGAAAAAGCGGTTTGGAGTGGGGTATCGCCTGAGTTTTGCCAGGCAGAATAATGGCGTAAGTGCAGCCGTGCCAACTCGG
GTTATTGCATCGTTAATTCAACAGCATGTCCCTCAAGCAGTGATCGCGTCCGATATTGGGACGGAGTTAACTTTTCAGCTGCCTTTTGAGGCATCTTCTG
GTTTTCCGGCATTGTTCCGTGAGCTGGAGTCTCGTCAGCAAGATTTAAGCATTGCTTCTGTTGTGATCTCTGTTACCACACTCGAAGAGATTTTTCTTAA
GGTGGCTGAGAGTGGAAGTGCACAAGCTCTGATCAAAGGAGGTCTAGATGACAATGGAGTCCCAAACTCGGGCGACACCTTACCAGCCAGTATTGAACCC
TGCGAGGCAGCGATTGTCGTGGAGCCCGCAAGAATCAATATGAAAGTGGCGATGACACTCGACGATCCTCAGTTGCAGCGTTGGCAGGTCACGTGTACAC
GAGTAATCCGAACGTTCGTGAACCACATGAAGGCATTGCTCCTTAAACGTGTGCAATGTGGCAAGCGAGACTTCAACATGCTATTTTTCAGCACCGTTCT
CCCGATTGTAGCTGTCTTCATCGGATTTTCTGCTTTGAAATTCTCAGTGATATTGCTAAACGACCCAAAACTAGAGCTGTCGTCAACCGTACAGTATTCA
CTTGGACATCAAACTCCAGTTCCGTATGGCTGTCCTGGTAATCTCAATCGGAGTGGTGGCGTAGGTACTACCTGGTGCTCTGAGCTGGTTAACCCAACGT
ACTTCTTGGAAGGCGTTGCGTACCAGCTTGAGATCGGCAGGACTGTGTTCGACGCATCGATGATACCTACAGTTTTTGGGGTAACTTACGACTCGCCTGG
CATTGAACCAAACGATACGAGCGGCTATAACCTAAGACTTGCCGAGTTGGTTTTTGAAAATGGATACGGATATGCTCCTGATGCCAATTTGAGTGCTTTG
CCAACGCAGGATGCCGTTGAAGGGCAGTTCGGTGGCTATCTTCTGTACGCGTCGGAATTAACCAACACTTTGAGCTACAACGTGCTTGCGAATGCATCGT
CAGTACATGCTGCACCAACATACAAGCATATGATCGACAATGCTATCCATCGCTTTTTGTTGGCAAAGGCTTCCGGTGGGTCGAGCCCCAACGTGACAAT
TCGTGTGTCATCACATCCTCTACCCCTCTCTTTCAAGACACGCTCAATTTTCAGTTCATACCTGAGCTTTCCTGCTGTGATCTTCATTGTGATCGCTTTC
ACATTTATTCCTGCTTCAATGATGCCATTCATTGTTAAAGAGAAGCATGTCGAGCAGAACGCTAAGTACCAGCAACTGCTTTCTGGAATGCCATTCTTCG
CATACTGGTTGTCGAATTTCATTTTTGATGTCACTCTATATCTCGTGCCGATGACAGCGACACTTTTGCTTCTTCGTTCATACGGCGTTACGAAGTCGCT
AAGCAGTGGCGACACTTGCGATTCATGCACTCAGGACGTCCCAGCTGCCATGGTCACCTTATTCATACTGTTTGGCACTGCAATTGCTCCGTGGACGTAT
TTGCTGTCTCACGGCATGGAGAAGCCCAGTGAGTGCTTGATCTATACAGTTATGATTAACTTTTTCCTGGGGCTTTTGCTATTGCTCTTAAGTTTCACGA
TGAATACGCTCGATTCAACTCGAGCGGCAAACGATGTTTTAGTTTACATTTGGCGCTGTTCACCACTGTTCGCCTTTGGAAATGGATTCCTCAATGTGCT
GCTGGCGGACCTGTTAGCAAATTTCGGCCTAACCAATACAACCCGTAGTGCGTTCGACTCGGATATCGCTGGCACAGATATTTGGTATTTGCTCATCGAG
TGCCCAATGTTTATTTTGCTCACTGTGGGGATTGATATAGTTCAAGCTGGAACGTTGAGATGGCGAATTGCCCAGTTCAAGGACAAATTCAATGCAGTGC
GACGTATTTACACACGTGTACCATGTCATAATGCCAAGCTCCACGTTCAACAAAGAAGCGCTGGAAATGTTGTAGATATTGATACAGATGTGGCTGAGGA
GTCTAGACGTGTACACGATAGTTATAACTCGTTGGGCACCAGCTCTGAAGTTGTTCAGATCGTCAAGCTCGAGAAAGAGTATCCAAACGGAAAACAGGCT
GTGAAATGCCTCTCGTTTGGATTGCAGCAAGGCGAATGCTTTGGATTCCTGGGTGTGAATGGTGCTGGAAAGACAACAACTATGAAAATACTTACTGGTG
ACCTACTACCAACTTCAGGCACTGCTACAATTAACGGTTTCGATATTCGTAAAGAACGACGCAAGGCTCGGAATTCGATCGGCTATTGCCCGCAGTTCGA
TGCCATTATTGATTTACTTACCGTTCGCGAGCACCTTGAGCTGTTTGGCCGGTTCAAAGGCTTTGAGACATCCGAAAGACTTGAAAAAGAAGTAAACCGC
TTGCTGAACAAGCTTCAGATTCAAGAATTCGCCAACAAACTTGCAGGTAGTTTAAGTGGTGGCAACAAGCGTAAGTTATCGCTGGCAATCGCAATGATAG
GGGACCCTAGTGTGTTGGTGCTCGATGAGCCATCCACTGGTGTTGATCCATTCTCACGCCGTCTTCTATGGGACGTCATTTTGGAGGCATCTGTAAAATC
TCGGCGCTCTACCATCATGTTAACTACGCATTCCATGGAAGAATGCGAAGCTCTTTGCAGCAAGGCTGGAATCATGGTAGACGGTGGTCTGCGCTGCTTC
GGTAGCATCCCACACTTGAAAACACGCTATGGTGACGGGTTTCTGTTGGAATGCAAACTGAATGCACCTCCATCGCACGCCATCTCCGACTTGGTGCAGC
TAATTTGCGACCACCTTCAGACTTCTTGCACAGAAGCAGCAGGGATTCAGATCACAACTTCACAGATTGCAGGAGTTTGCACTGCGCTTGGCAAACCAAA
GTACGCAGACATTGCTGGTGTAAGTTTCTCAGCGCAATTAGGTCGAGGTAATGGTGCTATCGACATCGCATCTTTTAGCAATTGGTGGCTGGTGGAGGAC
AGCGTGCAGCGAGTGGATAAATTCCTTCAAAGCCAGTTCATCGGCGTCACGCGCATCGAGCGCCAAGCCGATTTCTGCCGCTACAAAGTGTCGGGCATTT
CATATGGCAATGACGCTGTCCAAGCTGATGGCCAAGCGGCTACCGCACTGTCACGCATGTTCGAAGTCGTTGAGGACGCGAAGCACCGACTGGACATTAA
GGAGTACAGCCTGTCCCAAACTAGTCTGGAGCAGATTTTCAACTCGTTCGCTCGTGGAGGTCCTCGAAACTCGGTTGACAACAGCGACCTGAATAACGCG
AAGGTATTCGAGTAAAGTTGATATCAAATCAACTTCAACACTCCACTCCAGTCGCGACTAGCACATCGTGTTTCGAGATCGTGACGAGCTGACTCAACTG
TTGACGTGAGCAGCGGACATGACACTTGACAACTTGGAATTGCCGCCACCAACGCATATTAAGTTAGTAAAGTACTCCTGCAATGCGATGCGCGAGGTGC
TGCAACGCGCGACCAGCGACCGTCAAGTCGCGTTCAGACAGTAAAATCGCGATGCTGTCCGCACTCTTTTCGGTGCCCACACGATCGCCATTACCGCAGA
GATACAAGCACGAACTTCCGACCCTCGAACAGCACAATAATTATTAATCCATCCACTTTCATCGATCTTCCATCTCACGAACACCTCGAATCACTCCTCG
ACTCAAGCACTAAATAACACTAAATCACACTTGATCCCGTCCGCTTATCAACGTAGCACGACAAGGCACTAACTCAGGGCGCGTTCATTAGCGGAAAAGA
CGCGGCCAGTTCCCGCAAACCTCCTGACGAATCAGCTGCTGACTCTCTCTCTCGCCATTTACCGATTTGCGCTCCAGAACGGAGCCCGTCGGTACAACTC
AGAAGTCCTCTCTACGACAAGATGGTTCGCGTGCTCGCTCTCTCCGCTGCCGCCGTGGCCATGCTGGCGTCCTCAACATCGGCCCTGGACAAGAAGCTCT
ACGGTCTCAACTACGACCTGCGTCAAGGACCGGACTGGGACCCCTCCAAGTGCAAGTCCGCGGACACCATTGCGGCCGACCTCAAGATTCTGAGCACCAT
CACGTCCAATGTGCGCACCTACAGTCTCTCGGACTGCGATGTGTCGGGTGTCCTCACAGCCGCCAAGGATCTGTCGCTCACTGTGTGGCTCGGTGTCTGG
GTGTCTGAGGACTCGACCGTGTACGATAATGAGGTCAAGGCTTTCAAGAAACTCATCAGCGCTGGTCTCATTGACAAGAACGTCGTGGGCATCAATGTTG
GCAGTGAGGCTGTCTACCGTGAAGACATCACGGCAGAACAGGCCATCAAGTACGTGATCGACTTCAAGAAGGTCATGGCCGACAACGACGTCAGCGTGCC
AGTTAGTATCACGGACATCATCGACACGTTCGTGCAGTACCCGGACATGCTCAAGGCTGGCGACATTGTGACTATCAACCAGTTCCCCTTCTGGGAGAAG
ATCGAGGCTGACAAGGCTGTAGCTCAGTTCAACAAGCGAATCCAACCGCTGTTCAAGCTGGCTGGCGACATAGAGGTCATTATCAGTGAGACGGGCTGGC
CCACGGGCGGTACTGCCACGAACGGATCAGTGGCTTCGGAGGAGAACGGTGCAATCTTCCTGAACGACTTCTACCAGCTGGCTGAGTCCAAGGGCTGGAA
GTACTACTACTTTGCCGGTTTCGACACGCCCTACAAGGAGGAGCAGGCCGATGACGCTACTACAGTAGAGTCGCACTTCGGTATCTTCGACGACAAGGGA
ACCATGAAGTCGGCGTACAAGGGCCTCAAGTTCACCAAGAACGGAGACTTGTCCACTTCGGGCAGCTCCACCACGACGTCGTCGGGATCATCAAGCACAT
CGGTGGGTGCAGGCACTGTCGCTCCCGGAAGCGACACGACCACCGGCACGTCGACCGGCACGGACGCTACCCAAAGCCCCGGCACCTCCAGCACCGACAC
GGCGTCTTCGTCTGACATTACGAGCAAGGAAAGTGGATCGTCGCAACTTGTTGCTACCAGCCTTGCTGCCTGCCTTGGTGTCGTATCCACCATGTTCTGG
AACCTGTAAGCAAGAATCTAGTATCAGAGGTCTAATTCGTGTGGTACTAATGCACAAAACGCGATTGTTACGGTACTTCCTCAATTTTTGTTTGTGTGCG
ATACATCAAAGTCAATCCGCGACTATCGTTATGGCGAGCACGAATACGGAGGCGAATGGTGCGGCAAGCAACGAGTCGGCGAACGAAGGGCTGCTGGTGC
TCGTGATTGACACCAACCCCGTGCATTGGTTTACTAATGGCGGTAGTGCGGTCGACCGCGCTGGGCTACAGCAGCTGATCTCCAGCACACTCGTGTTCGT
CAATTCGTATCTGCTGCTCCACCGCAGTAATCGCATTGTGCTCATTGCGGCTCACGCCGGCAAGAGCTCTATGCTGTATCCAGATCCTGAGCAGGGCGAT
ACTAGCGGCAATGCTGAGCAAGCTGCTAAGGTCAACGCTGGTGTCTTGCAGCGTCTGCAGCAACTCAGTGACGCTCCGCTAGATCCTGCCAAACCGAACC
AAACGGCCATTGCGGCATCGTTATCACGTGCATTATGTTGTATGTTGCTGTGATGGCGATAAAGGTTTATTATCTATTAGTACTGATGCTGTCTTTACTG
GTTGTTGATGCAGTCATTAATCGGGCAATTAACGAGGAACCGGATCTGCGACCTCGGATCTTGATCATCCAGAAGTCTCCAGACGTGTCGGAGCACTACA
TCGCCATCATGAACGGTATTTTCTCGGCTCAGAAGAAGAACGTGGCGGTGGACGCTTGCATCCTCTCGACAGAGCACTCGTCGTTCATGCAGCAGGCAGC
GTATCTTACCGGTGGCATCTACTACAAACCCAACGATCACAGCGGACTGCTGCAGTACCTGATCTCGATCTACCTTCCAGATCCGTCCATGCGCAAGTTG
CTCAAGTTACCGTCACAAGACTCAGTGGACTTCCGTGCAATGTGCTTCTGCCACCGTGAGGTGATATCCACAGCTTTTGTTTGCCCCGTGTGCCTGTCGC
TGTTTTGTGAGTTCCGACCTATCTGCTCTACATGCGGCATTCGCAGCCACATCCAGCCAAAAAAGAATGGTTTAAACAAGAAGCGCCCACGCGTGGCTTA
ATAAAAGATGGCACTGCTAAGCAAGCTGAGGTGCATCGTTGTTGCTGTTGTTGTTCCTGCACTGTTTTTACCACAACGCTGACCTCCATCGCCGATTTCG
ATTGGCTGGGAGAGTTTGCGATGGCAAAATCAAGATTATGCGCATAAAGTCACACTCTGATTAGTCAAAATACCCGTCAAGCACGTTTTCAACCAATTAC
CATCCGCTCAAGGTGGTAGTGACGTTTTGCAGGCAGGCCATTGTGAGCTCTCGAGTTGCCATACTCAGAATCTCCACGCAAGCAACAGATCACAGCAACA
TGAGCAGGTTCGAGCAGCCTCATGCGTCCCGAACAGAGTTAAGAGGTGTACTAATTGATTGAACTGCATTTATGCTGCAGACCGACCATCGCAGAGGTTA
TCGCCGAGCGCAAGGCCAATAACACAGCGGCTTTCATCACCTTTGTGCCCTGCGGCTTCAAGACCAAGGCTGACACGGTGGATATTCTGCTGGGACTGCA
GCGTGGCGGTGCCAACATCATTGAGGTGGGAATCCCGTACTCGGACCCGCAAGCCGATGGTCCGACCATCCAGCGCGCCCACCAGGTTGGAGTGGACCAG
GGCATCACTCTGCACGACGTCCTGGCCACGGTGAGCGAGGCGCGTGCCAAGGGTCTGACCACACCCGTTGTTCTCATGGGCTACTACAACAATATTTTCC
AGTATGGAGAGGACAAAATCTGCCCCGACGCCCAAAAAGGTAAGACCTCAATAGCGCGAAAGAGATGTTGCGCACTGAGCTGGCCAACTGATTGACATAT
TGCTGATTTGTTGCAGCTGGTGTTGACGGATTCATCATCGTGGACTTGCCCCCTGAGGAGGCAAAGCCGCTAAGCGACGACGCAGCAAAGCACGGCCTCG
CCTACATCCCGCTAGTGTCCCCCACAACAACTGAGGACCGCATGAAGCTTATCGACTCGGTGGCACACGGATTCGTTTACTGCGTGAGTCTTACTGGTGT
CACGGGTGCCCGTAATGAGCTGCCACCGAACCTCGACGCGTTCATGGCTAAGAGTACGTGGCTGACTGTTGTATTGCATGTGTGAAACATTGAGCTAACA
AGACCCACTCTGTTTGATCGCTGTAGTTCGTGCCAACGTGAAGCATCCACTGGCATTGGGTTTCGGTCTATCGACCCGCGAGCACTTCGTGCAGGCCAGT
GCGCTTGCTGACGGCGTCGTGATCGGTTCGAAGATTGTCAAGATCATCGAGGACGCTCCCGACACGGCCACGCGCGCTGCCAACGTGGAGGCCTTTGCAA
AGAGCATCGTGAATCCCTAAAGCCTCAACTAGGACTGTTGTGTTACGACTGCTGAGCTTCGTCAGCACCCCGTTCCTACAAATATACTAATAGTCTAGTA
CCAGTTCTTGGACAATTTACAGTAAAGTTGCATGTATTAATCCAAAGTTGGCTGTCTGTGGCTCAGATGGCTACGGCGGGCGCCTTTCTGCCTCAGTTGG
TTGGCGTGGGTTCGAGTCCCGCAGTTGACAAGCATTGCCAGTTCGTATTTAGGAGAGTAGTATACAGTTCGTAGCATACTTCGAAGCCCGGTGTGTCTGT
GCCATTAGACTAAGGATCGGGTCAATCTGTGTGCGATAGTATCAACAGCGTGTCAGGGTGTCAGTACTGGGTGATTGGTCAAAAGTGCGAATTAGTCTCA
GAATCTGCCAATCGACATGCGAACATCATTTTGGCGAATACGAAAGTGGTACGCGAAAGGGTGCAACTCGGATACGGTAACTGCAAGAAGTCCACCATGG
ACGCGTTAGAGGCCATGAAGAACGAAGGCAATGCGCACTTCCAGCAGAAAAGATTTTCCGAAGCCGTGCGCATATACAGCTCCATCCTCGATCAACTGTG
CGACGTTGACAATGGAGCGGCTGCAAGACTGGAAACTGCAGTGCGGCTCAACCGCGCGTGGGCATGGATCCAGATGCCAGATAATAAAAGCAATGAGTCC
AAACTCGCTGCAGCAGAGCAGGATTGCACTATAATAATTGAGACAGACCCATCCTGTGTAAAAGCATTTTATCGCCGAGCGCTGGCACGAGAGCGAAGAG
GCCACTGGAAGGTAAGATTGAAGTCATACGCACTAGTTGCTCGTGTACTCACGTTTGATTGTACAATTGCAGTTAGCAATGGAGGATGCAACTGTGATCA
AGCAACTCGAACCCGGTAATCCTTCTATCAGTCCATTGCTAGAGAGGTTGCAGCAACGCAGTAAGGAGAACGAAGGTTTGGTACCGAAATTCCAGCAGTG
TACGATTAAAAGCGGTGATAAGGCACATAGTGCTAGTGAAAACTCGAGCATCGCCCTGGCTGGCGAAGCGGAAGATGCATGGCGCATGCTACAAGCAGAT
GAAATGAATTTGAAGCGAGTGTATCAAACTGCATCAAAGCGAGCGTCAAAAAGACAAAAAGACAAGAACATACCTCGAAATGAGTTCCCTATGAAAGGAG
AGATCTCGCACAAGACGGATGATTTATGGGAGTCACTGAGGCGGGAGGAGATCACAACTGTCGCTAAAGCATTTCCGCGGTCGAAGAAGGGTACAAACTA
GTTAGATTCGTCAGCATAAGTTCGTGTCGAGTTGCCAATAAATGATGGACACGACAAGGACACTGCCGAGGGGCTCACTATTATACAATAAAAACTCTAC
TACTCCGGAATATGTTATCCTACCAATCCTCCTCGTCGTCGTCGCCAAGGTCAATAAGTTGGGGTCGAGACCGCCGATAGCGAAGGCCACAACTTGAGCA
GTTAATACTGGTTGGCGGGTTGATCAATGTGCATCGTGAACAGCTCCAAGCAGCCGCAGGCTCATTCGCTTTGTGCTTTTCGTCGCTATGTGTGATCTCG
CGAGTTGATCGAGAATCACTCAGGACATTCTCAATGAAGGCATCATCGTCATCAGAATCTGAGAAGTCACTCGTCTTTTGCTTCTTCGACGGCGACCATG
AACCTGAATCAACCTCAGGCGCAAATGTTACTCTTCGCTTCAGTTTAGCAGGCTCCGCAACTGCTGGTTCAGATTGGACTGGAGCTGGGAGAGATAACTC
ATCCAGCGAAGTTGTCGGATGCGCGGGGCGCCGAAGGGGAGGTTTTGGAGTGCACGATATATCGACTTCAGAAGCTGGCGAACCGCGCTGAGGTGCTTCT
GACAGAAACGCATCTTCACCTTCGCTCTCTGATTTACTTTCCCCCAGGATTTCGTTGTTTTCGTCTTCATCAGTACTTGAGTATTCAATCTCCGACTCAC
CGGAATCGTCAATAATTTTGTTTTTCTTCGATTTCGAGCGTTTGGGCTTGCTCACTTTTTCAGCACGCTGCTTGTTTGCAGCGATAATCTCCATACGCTT
TCGTTTGCGCTCTTCATCACGTTGGTTGTCTCTTTCTTCATTTTCAGCTTGGTGCTCCTGAAGTAACTCCCAGTCAATCCGACAGCTGAATGCAAAACTA
ACTAGGTCATTCTGAACTTGCTGCAGAGCCGCCTGCATTACCTCGTCATCGACAGAAGCGTAAGCACGGTGGTGACCCCAACTATTCAAATCTTCTTCTG
GCGGCATGCCAATTTGCGGGTGATAACCCTTGTCAGTGTGCTTGTCAGTGTCCTCATCACTAGTGGCGTCTCTTTCAGGTGAAGTTTCGTTTTCTGTTTC
CTTTGCACTTTCATTATCTTCATCATCAATCGTAATTACAGACGAAGGACCTTCACCAGATTTGCCAGTATCTCTCCATTGACAACGATCACATTTTAGC
TGGTCGTGGGTATCGGACATGGTGTCTTTCCTGAACACGAAAAGCCGTTTCAAATCCTTAGAAGACAGCGAGTTCACTTCCTCTTTATCATCAACGATGT
TTTGAAGACCCTCTTTGGATAGCTGGCGTTGGAAAATTTTCTCTTCGAGAGTTCCCGTCGCAAGGAATCGGTACACATAGCACATCTTTTTTTGGCCTTC
ACGCCATACGCGAGCAGCAGCTTGCTTGTCAGTGGCAGGATTCCAGTCAGGATCAAAGAGCACCAATCGATTCGCGCCAATTAAGTTCAAACCACACCCT
CCAGCTTTACTTGACAACAAGAACGCAAACGAGTTTGTTGTTGGGTCATTAAAGGTGTCAACAAGTTTCTTCCGCTTCTTTGCAGAAGTTGTTCCATCCA
GACGAACAAAGGGCAAGTGGCGTTCCTGACAAAGGGTTGATACGACATCCAACGTCTGCGTATAATTTGACACGATTACAATCCTGTCCGTTGTTGTCTT
CCTCATCGAAAACATTAGGCGGTCGAGTAGAAGCATCTTTCCAGACCATTCAGGGTAACATGTGCGTCCACCGAAGCCTCCTCGTCGATGACGACCGTTG
TCATTTCCGCTGTCTCTGGATTCCTTGGCTGCCGTGAAATACTGCGCGCAGTTACCAAATCCAGGAAGCTTGGTATTTGTCTTCCCCATTTCATCAAAAA
TCAGGAGCGGGTGGTTGCACAACTTTTTTAGTGCAGTGATTGAAGATAAGACATTCGTGCTCGATCGTTTCATCATGTCTCGGCAAGCACTGGACGACAG
AAAATGCATATAGAGCTGCTCCTGCAATGGAGACAGAGGACAGCAAATTACCTGCATCAATTTTGGCGGCAAATGCTTCGCGTTCAGAATATTGCCTCGG
CGCAAAATGAACTGATTCACAATTTCACACAGCATTGCTGAGCATGACTGTGCAACTCCTCGCTCACGATCAGTAGAGTCTGGTTCTCGTCCAATCAAAA
TAGGCCCCAAATAATTCTTCCGGAACTCACTTGGCGTACCAAGGATGTTTGGGTTAGTAAAGTCCACCATGGCGAAAAATTCTTCCAGGTCATTCTGCAT
CGGTGTACCAGAAAGAAGCACACGCTTCCGACACGCCAACGACGACAACGCCTTGTTAATCTGTGAATTAGCGTTTTTGAGTCGATGTGCTTCATCACAA
ATCAACAACTCACAGCAAGCTGGTGTATCTGCGAACTTTTGCGCATGCATGCGGAACGTCTCGTACGAAATGATGAGTACTTGAGCAGAGAATCCCGGAC
GTGGTCTCTTGCTTCCCTCGATAAACTGATTAATGCCCTTAATCACAGTCTCACGCTTCGCCTCAAACAGCGCCACCGTCTTCACACGTCCGTGCAACCA
CTTGATTATCTCATCGTCCCAATTCTTCACTAACGACGTCGGACACACAACAATTGCTCGATTCACCGTTGGTTTCATGTCCATGCCCGTCATCAATAGC
GTATACATCAACGTGATACTCTGCAGAGTCTTACCAAGACCCATATCATCAGCCAAGATGCAACCTTGTCCGTCAAAACCCCTCACTTGAGATACACAGT
CGAACATGAATTGCACTCCTTCACGTTGGTGTGGACGTAAAAATTTGCCCACGATCTCAGGCACCACTACTTTAACATCCGGATCTGTCTCACTCTGCCA
CAACACCAAGGGGGGTGGTACATTCTCTACTGGAGCTGAAACAGGTGCAGATTCTTCAATTACTGGAGGCTCTAGATTCACAGGAGTCTCAATCTCCTCG
ACTTCCACTTCAATAGGCGGCAATTCATGGCGCACCATGGGTTTCAGCACTGCGCAGCCCCAACGTCGCCTCATCCCGAGCGTCTTGGTCTGCAGCAGGC
GGTTGCTCTCCTGTGTGCGTCCTCCTTCTCCACATGGAGACTTAAATGGGCGACGCACGCGCTGAGCTCTGCGTTCTGGCTCCATTACTAGGAAAGACAG
GAATGGGAGGCGCTTGACGGACAGTGATGCGCCACTGCGCAGCGCCTGGCGATTGCTGGCTGCATCGACATCTTCATATACGTCTTCTTCATCGTCTTGA
GGCTGGACACGCGTCGGGGTCTTCACAGGCAGCACGAACGGCTTGAACTGCGCGCCTCCGCCAGGTCGTCGCCTCAACATATCGCTGGACGAGTTCAAAT
TGCGGAAATGGGACTAGGGAGTGATTTGATTGGATAAAACAAGTATGACCATCACTCAGATGCGGCTAGTGTTAGTACGATTTGATTGGATGTAAAAGGT
ATATTAAACTGAAAATAAAAACCAATGGGAGACTAGACAATCGCATCCGCAGATAGTGGTGCACGATGATGCAGGTGGCGGCGTTCCAGCGTGCCCTGCT
ACGTCGGATTCGAAGCTCACAGCTCCCTCGTACAAGCCCTGTTAGTAAACTAGACAATGATCTTCCTATTGCTAGTCTCCGACCTCGACAATTCGCGCTA
TTGGCTTCAAACGACGGACAGGAGTCTCGTCACAATGCTCTACAGCGACTTACTGAGACTTCCAACCTGTCGTGGAAACTGCGCGCCATCGTGAAGAATG
TCGAACAATCTTTACCTTCAGACAGAGGCAGGAGATTCTACAACCGCCGAGTGGTGGAGGCCCTGGAGCAGAGTGATCTGGATCACGCATTGGCTATTTT
GCAGACGTTGCATCGACGACACCCGGACAAGGCTGTGCTGTGGCCTTACACATACAACTTATTGTTGCGTCACTATTGCAAGCAGCAAAAGACAGTGATG
AACGCGAATCTGACGCGCATTCTGGCCGTGTTGGAGGTGATGGTGGCTCACGACTGTGCAAACCAGACAAGTTTCCAAGTGGCGATGGCTGCATGCAGTC
GTGCACGGCATCTACGCAGTGCAAGACATGTACTGGAGAAAATGGAGGAAAGTGGATGGGAACCGGATGCTAAGATTTATGCTTTTCTCGTCAACTGTTG
TGCGAGGAAGCAGGGACTGGTGAAGACGGCGGAAGAGTATTTTGATGACATGTTGAGAGCTGGAGTGAGACCAACAGTTTTGGTTGTTAATGCGATGCTG
CGAGTGTATTCGAGAGACAGTGGACGATCGAAGGTTATACTGGAGCTTGTAAAACGTGCACGTGATGAATTTGGTTTAGTTCCTAATACTGTCACAACGC
GGTTGATGGTAAATTACTTACTTTGTGAGGGTGACGTGGATGCCGCTGTGAAGTATCTGCGTAGTGTTGAGAGTGAATTCCCTCGTGAAAAGATGATAAA
ACTTCCATTGAAACGCCAAGTGGTGAATTCGCTGATCGATGCTTGTCGTCAGCGTAGCGAATGGAGCTTGGCTGAGTACGCATTCACCCTTGTGGAAAGG
ACCGATGAGGGCGATATGGTGGCAGCCAAGGCCGAGCACGATGTGCAAGACACGCTTAAACTGAAGAAATTGGTTGTGAAGCGTGACGCCTTGTCTTCGG
CGGTGGTCTGGCGGCTACGTGAATACGACTGGTCTCGTATGACACGACCCGATAAAGAAGCATTCTTTCTGAATCGAAGTCAGAAGGAAAGTATTGATCG
CGCCTTGGATCGAATGCATTTACATATTCCTGCATCTAGGGCTGATCGATCTATTCAAAAGTTATCCCTGAAGCTGGAGGGTAAATTACGTGTTCTTGAC
GAAATGATTCACAGCAGGAACGCAAGTGCAGATGATTTCAATGCTGTATTGGGTGCTTGTGGAAGACAGGGTCAGTTGGATAATGCTTTGTCCGTCTTCA
CAAAGATGAAATTATATGCGAGATCTTTGCCAGAATGTACACCATCGACTTGGAGTTACAATGCGTTATTGAATGCTTGTGCGGTCCGTGGTAGTATCCA
CCAAATTGAATCAATAGTCAACGAGATGATCGAGAATGATTTACGCCCTGATCAAGTGACCCTGAACACGGTAATTAAAGCGCATATCACTAGCTTGAAG
AATGGTGCACGTGGAAGTCCACAGACACGTCTCAACATTGTGATGGAAGCGCTGTCATTCTTTGAGTGGTGCACTGAGGACCAGAAGGTCGATTCAGGAG
CGGCGACTTATTATTCGCTGTTTCGGTTATTTGCTACATACTTAGAGATACCTGATGAAAACAAAACTACTCCTGAAGAAAAAGACCAAGGGGAAGATAA
CGCAGTTGAACAGAATGATGAAGTATTAACCGATGGACAAGAGGGAGAATTGTTGGTGTGGATGACAGAGTTTATAACCACCACATGCCGCGACGCACCA
CTTTCATCACTAGATATCGGGGTCTTCAACAATGCATTCGACTACTATCATAAGCTTGGTGATGTGGACGCATCGTTTGCGCTGTTTAATTTGATGAAGA
CGCGCGGGATTCAGCCGGATGATGCGACTCTCGGTTTAATGTTTGCAACCTGTGCAAGCGAACAGCAATTTGAGGTGGGCTTAAAGTTTTTAGACCATTT
AATGGCTGCAGATGACTACAAGCCAACATTGAAGGTCCTCAGTGGAGCCATGCAGCTGTGTGCAAACTCAAAGAACCCGGATGGGGCGTTAGAGCTCTTC
CGAGCTATTGAGACATCAGGAGCATTTATACCTACTGTAGAAACGTACGAGCCGATTGTGTTCGCATATGCTCGTGTCGGGAACGTGTCCAGTGCTTGGG
ATATCGCAAATGAGATGGAAGCGAAACTAGGGAGGGTCTCTGTGAGTATATACAATCGTATTCTATTAGCGTGTGTCGAGGCGGCTGTACCTGGACGTGC
CCTAGAAGTATTAAGTGTGATCCGACATAAAGGAGGAGTGACCCCCGACATCATTTCTTACAATACGACGCTGGAAGCTTTCGTTAGAGCTGGGGAGCGA
GCTGCGTGGTGGAGGAAGAACTATATTGGCGGGGAAGAAGTCGGTGATGTTGATTTTAATGATGATGATGATAATTATGCCGATGACGATTCGGGTGATG
AAGCTGACGAGGAAAACAATGACCTAGTTGACGTGGTTGGGTCGGAGAAAGCACGTGTAAGTGGAGAATCCACGGTGATGGCGACACCAGCACCAGATTA
CGAGATTGAACTGCGCGAAAAGGCTGCATGGGCCCGTGCTAGTATTATAGACTTACTCGAAGAAATGCAGCGAAGTCGAGTGAAACCCGATATGACGACT
TATGAACGTGCGATAGCTGCTTGCAGTGTGAATGAAGACTCCGAAGGTGTGATCGCCATATTTGACAAACTCATTGATCGCAAGCGTGGTAATGACACCA
TTGAGCTGAAAAGTGACCTAATGACAGAGTCCAGTTTTTCAGCTTACCTCGCAGCATGCACGTCATTACAAGACAAAGATCGAGTCGTTGAAGCACTGAC
ACTTCTCTCCAAGTGGCACACCGCGACAGGCCAGGTTCCACCAGAATTTGTTGTGACGCAGTTGTTGGACTTTCTGGAGGATCTGGGGGAATGGCGCCGT
GCTGTCCGGATGCTTCCCAATTGGCAAGCATTGTTCGGTACTCCACCTAGTGTTATTGTGTTCAATAAGGTAATGCAAATGTGCAATAGTGCAGGAGAAC
ATCAGCTTGTGGCTCCGATATTCGCTACTATGCGGGATGCAACAGCCTATCGCGTTTACCCCGATGCAGAAAGCTATACTCAACGGATTTACGCCGAGGA
ACAGCAAGAGAACTGGGTAGTTGCAACAGACCTATTCATCGAGATGCAAAAGAGATGTCCAAGTGATGAGATTTCACGTCAACATCTTCACAAGATCGCA
TTGGGTCGGTATAGTTTGCGTCAAAACGAGAATTAATGTTATAAACGACTCTGGTGAGTAGTGTTACCAACACTTTATTCATCATTTGATCATTTTCCAG
AAATAAGACTCGTAGTCTAAGGGTGTTCATGATCACATTGGGTTCTCAAGCAGACTCTCCTCTTCGTCAGGGATCGTAGATGAAAGAGTCAAACCGAAGT
TGGGGCTGTCAATGAAGCCGCTTGATGTAGTGCTGGTGCTACTGTAACCTTCTCCGTTGCTGCTGCTCGATTGCGCGTAGATTGACTTATCTGAAGCATA
GCAATGGAAGAAAGCCGCACCAAATACGAGGATAAGTGCAGCAATCGCAAACACGAGGTCCCATGATCCTGTAGCTTGTAGAATTGCTCCCGTGACCACA
TTGCCAATAATACCTGGGATTGTACCGAAGGTGTTGGAGACTCCCATAACATGAGCAGCATGGTTTGGTGCCACATCTATCATGTTGACCCAGTATCCAG
CCATAGCAGCTCGACTTGTAAACAGCGTCAGACACAGTAAGGCCACTGCCATGGGTGCTGTCTTCGCGAGGCGCAGCGAGAAAAGGAAAAAGGCACATCC
GAGGAACGAAAACGCGTTCATGGCTTGGCGTACGTGCAACTCACGGTAGCCTCTAGTAACCAGCAGATCTCCAAGACGTCCGAACAGCAGCGTTCCGGTG
TATCCGCACATGTAGGGCAACGCAGCGGCAAACCCACCCTTCTTGGCTAAGTCGAGGTTCAGAGCTTGGTTAAAATACTGGGGGATCCAGCCCAGTAGTA
TGTACCAACTGTAGTTATAGCACATGTGTGCAACGTAGATCGCCCATGCAGGCCGCGAGGTCAAAAGCACACGCCAGTTCATCGCATGCGTATCCAGCTC
AGCGCGCGAGCGCTGACGACGATGCGTGTCTGGATCGACGGTGCGATTGAGAATGATGAAGCTGCGCTCCTCAGCGGTAATTTGGGGGTCGTCCTCAGGT
CGACTCACTCCCATGATCATGTACACTACGACCCAAATGAAGCTAAGCACGCCAAACACAACAAAGATGCGTTGCCAACCAGCGGATGCCATGATAGCAG
GCGAAATAATCAGCGCGGAGATGGTGCCGAGATCTGAACCACTTGCCACCAACGACACGAGTCGACTCCGTTCTTGCACCGGATACCACGCACCAGCAAT
TTGATGCATACACGGGAACAAGATCCCCTCTCCAAGTCCCATTCCTGCTCTCGTGAAGAACAGACATGTAAGGCATTTAGCCACTACAACTGTCGACAAG
TCCTACGTGACAACAACAAGCATGTCAATTCCAAATTCCTCACTAAGCTAAATCAATGGCCACATACAAACAGTGTCCACACGATAACGCCCGTCAATAG
AACGACCTTGGCGCCTAGCTTGGCAGCAAAATACCCTCCTGGGATCTACAGCAGAAAGCGACAATCACTATAAAACAGTGTTTCTGAGACTGAAGATCTG
CTGCGAACGTACTTGGGTGCACATGTAGCCATAAAAGAAGGCGGAGAGCACTTCGCCCTGCTCCTTCTTATTGGTCACAAAAGCCGGCAACGCGATGCCC
ATGTTAGTGCCTAATTCATCAAAACCACAATCAGATTCCGAAGAGCCTCCGAGCTAACAGATCCTACGTACGGTCAGCGTAGCAGATGGTGGAAACACAG
AGACACAGGAATGCCGTCACATAGCGTCGCTTTCCCTGTGGCAACTCCACGGAGACATCCCCAGCACACACGACGTCGGCTTCCTTCCACACCTCTGCGC
TCGCCATCCTGATGGCAAATGAGCAGATGTGAAGATCGCAGCCGTTATACTCATCAAGATTTTAACCAATCACAGCAGGAATAACCACTTCAACATGCGT
CACACTGCTCAATCAAGGTTTTAACCAATCACAGCAGGAAGAACCACTTCAACATGCGTCACACTGCTCAATCCTTTCGCACACCATTCGCATGGACAAC
CAGATAAATTGACATGCTCGCACTGAGCAAATATGCTTACAAGACGGGGCTAACGGAAGTTTGTGGTCTCGCCTAGAGGCGACTTGGCACGATATCGCTT
TGGGGCTGCGAGAGCGGACATTTTGGTGGTCTTGCGAGCTGCTGTGCCTGCACTGGGCACCTTCATGCTCCTGTGCGTGTGAGGGACCACGGGTTTCTTT
TTGTGCAAACCAGACGGTTTTGCTTTCTTGATCTTGGACGGAGTGGTGTTGAGTGTAGTGGCGGTAGTGGCAGGATTGGTCTGAGGTCGAGATTCCACCT
CTGCAGCTGCACTCGACTGGGCCGATACTGGGGCAGAGTTCACCGCATCTTCGCTACTGCTTGATGCAGTGCTAACAGTGGCAGTTCCGATCTCAGTGCT
GACTGGTACATCGCTCGGGGTCTGCACACGGGTGTCTACTACAACCCGAGAAGCATCATTAATAGCACTCGAGCTAGCATCGCTCAATCTCCTGCGCTTG
TGGCATGCAATAGCCTCACTGCTGGACGCGTTGACATCACTGAACGAAGTATTCGTAGCAATGAGATGCTCAACCGAAGCCTTAGTTGCCTCGAAGGAAG
GGAACGACCGGTCGTCCTTCTTCATTGGGGTAGTTCCCGTCTGTACATTAACCTACACAGCACATAACAATTGAGCACAACTAACGGGTGTTGCAAGATT
GCATATCGAAACGATAGTACCAGCTTACCTTTCGTTTCTTCATGTACGTCTCCATATCTTCCAGGTGCCGGGAGGACACCTTGGTCGCTTCGCCAACAAT
TTCCTTGCTAAGCATTGATACCGACTCAATCTTGTCCTTCGTGCTTGTGATTTGAGTTTGGAGACCCTCCTCCATCGTCTTAAACCCACCAGTTAGGAGC
TGTCGGAGCTCTTCATGGTCAGCAAGGAACTGTGTCAACTGTCCTTGCCTTTTGGACGATATCTCAGCGTCAGCCTTCGAGTGCTTCTCCACTAGGGACG
ATATGTCTACTATATGCTTTTTACCTAGCGCAGCAGCATCGTTACTCCACGCGGTTTGCAGTCGCTTCTGAGACTGGACCAACTCCGCTTGCCTCTCCTT
AGTTTCATTTAATTGGTCTCTCATCTCCGATAACCGCTCACGAAGCGCAGTTGTCTCGTTTTCGTGTTTTGAGTTTTGACTGCCAATACTCTGCACGAAG
CCCTTCATTTCTTGTTCCGTGATGTTCTGTACGTATGAAAGCTGTTTGTGTTGCTTCTTTGCGCTTTCTTCAATAAGCAATGTCTGCTCATCAAGTTTCT
GCGTTTGGCTCTGGATGCACTTCTCAATATACTGAGCAAGATGTGCTTTCATGCCATTCAGCTCCTCTTGTTGATGAGCGTGACTGTCTTTTAGTGCAGC
AGTAAGTGCCGCCTTGCTTTCATCGAGTTCTTTCGTCTGTTTCTCAATTGACATGTCAATTGTGACCTGTAGTTCTAGCAACTTATCACTTTGCTCGGTG
AGGAAGCTGCTCAGTTCTTCGCGAGAGCCCTCCAGTGCCGATTGTACGTCTGCAAGGAATGACATATTCCGTGATTTAGTCGATGCCAGGTCTTCAATGA
TAGCTGACGCGTGGTTCTTGGACATCTCAACAAACTTCTCGAATTCCTGTTGCATAGCCTCTTGTTGTTCGTTCATCGACGTTACAACTTGTTCTCGATG
CCCCTGCTTTCGGGCATCATCTTCAGCAAGTGTTTCGGTAGCCTGCGTTCTACGCGCTTCAACAAGACCTTGTAGAGCATTCAGACTCGTAGCCAGGCTA
TCCAAATCAGTCGAGTGGGTTGTTTGCAGATCGTGCAGAGCATTTGATACAACCTGAAACAAGCCTTCTTGATTCTCCTTGTGCTCTACCAGTCGCTTTA
GGAACGTGTTAATCTGAGATTGTGAATCACTTCGATAAGAAGTTGCCAGCGCTGTGTTCGCTTCTTCTGCACGCTGGGTGTTCTCTACAATCAAGAAACT
CTTTAGTGGAGGAAATTACAAATCGGAAGTATACAAGACTTACCAATCTTCACCACTAACTGGGCGGCACGCTTCTCACTAGAGTCATATAACTTCCCTG
CAATAGCTCCGTTTGCTAGTAGCACCTTCTCATTTTCCTGGAAAGCTTTCAGCACACCACGCACTTGTTGTAATTCTTGGTCCATCTTCTTCAGTGTTTC
CTTTGTGAACGTAAGCTCGCCTTCAGTAGCAGCTAACTTGTTGCTCACCTCCTGTTTTGCAAGTGTCAGTGTTGCCATTTCGCCCGCATGCTTTTCGGCG
GCTTCCTCGAGCTCTTTGCATGACGCGTTCCTTGCCTTTAGCATTTCTTCTAGCTCTGTTAGTTGGGCACCCTGACCACCCAGTCGCTCTTGCATATCAG
TAAATTGTTCCAGTGGTAAATACACTCCGTCTTTTAGTCTAGCAGCATGCAGGGCTGCACGGAGCGTCTCAATCTCGCTTCCAAAATCATTGAGCAGTCC
AGCCTTAGTCATTTTTTGATTCAGCTCCGGCTTGTTCTTGATGTGTTTCGCGCGGAACGCATACTCCAATGTACTCAGGGTCTCGTCAAGACTATCCGCA
CAAGGAGCAAGAGTTGCAATAATCGTCGTTTTTGCTCGACCTCCGAGTGATTCTTGCAGTAAACGCGTAAGTTTGCTATCGCGGTACGGAACGTGCGGTA
GGTTGTCAACCAATGCCGTGATGACACGCCCCAATGTAAGCAAACTCTGGTTAATAGTGCCTGCCTCACGCGCTCTTGCATTGCGTGCACCCGAGCGACC
CACACACTCCGAGCCTGCCAAATCTACCAAATTCAGTTGTCCCACACGCAGCAAATCCTCGCCAGCCGCATTGTGCTCTTTACTGTGGATCCTAATAGTG
AAAATACTATGCGAGCGACTGGAGTTCTCGTTCATCAGTGTCTCCGACGTAATGCGATTCTTCACTCCTGTATTCACCAGCTCGTACACGTGCTTAGCTG
TCGTTGCTGTGACTTCCAACAAATTAATACAGTAGATTCCGCCTCTCTTGACGTCCTCCATGAGTCGCAGCTTCTTGTCTGTATCAGGGTCCAACAAATC
CTTCAATTCTTCATTGTAGAGCTGCAGGAAGGACACACGGACGCTAAACTCCTCTCCCTTAGCTTCCAGAGCGTCAAAAATGCAGCGCACGCTGCGTGGG
ATGATGCCAGCCATTTCACTTGCTGGAGAAAGGTCTCCCTGCATCGTGTACGTCTTGCCTGTGCCTGTCTGGCCGTACGCGAAGACTGTGCAGTTGTATC
CAGCCAAAGCTTCGTCCACAGCCGGTCGCACTACGGACGTGAACACATCCTTCTGTGTAGAATATTGGCCGAAGACGCGATCAAACGTGTACGTCTTGCG
CTTGACCATAGCCACCTCGTTTGAATTAGGCTTGCACTGCACGACGGCGCCCCGTCCTGCAGCCTTCTCGCGACTGTTGAGTGGACGACAGCGCACTGCC
ACCTGCACATTCGTAGGCGTAGGAGGCGCGTCGTGGCTGGAAGCAGAGGAGGACGACATGCGACGGTCGCTCGTCTCCGTCATCTCACGGTCAACTTTGG
ATTTGAATTCAAAAGTGCGCGCGTAAAATCAGAGTGATGGTCATCCTCATTTGAGTGTAATTTGAGGGAAAACCCTCATTCGTGTGTACACACCATTTTA
TCTACTGACCAACCAAAAGTGCGTTTGAAGCGACATTCGACTCACTCCATCAATTGCTCGACGGCCATGACGCAGCCCAAGGTGAGCGAGACACTGCTGG
ACGGACAGAAGCCCTTCGCCGAGTGCGAGTTCGGCTTGGATCGCCGCCTCTCCAAGGCGGTGGCCAAGATGCGCTTCGTCCATGCGACATTGGTCCAAGT
GCACTGCATTCCGCTGGCACTTCAGGGGAAGGACTTGTTGGTGCGTGCGCGTACGGGTTCAGGTAAGACGGCGGCCTTTGCACTGCCATTATTGCACAAG
ATCTTACAGCACAAGCAGGACGCACTTGCCAGTGAGCCGGCTGTGCGTGCATTGGTGCTGGTGCCCACTAAGGAGCTGGTGGAGCAGACGCGTCGCCACA
TGATGGAACTCATGTACTATTGCCAAGACACAGTAAGTCTGTTGGCCCTAGGCGGACAGAGTATGAACGCGCAACAGGCGCTGCTGCGTGATGCGCCCGA
CGTGCTGGTGGCCACACCTGGTCGTCTTGTGGCACACTTGGAGGCTGGCAACTTGACACTCAAGGACTCGGTACAGACTGTCGTCATTGATGAAGCCGAT
TTGGTGCTGTCTTTCGGATACGGAGAAGATATCCGCACCATTTTCAACGCGCTGCCGAAGGCGTGCCAGACTTTCTGCATGTCGGCGACGTTGAGTCCCG
AGTTGGAGAAACTCAAGCGCTCAGTGCTGCACAACCCTGCGGTTGTGAAGCTTGAAGAGGGAGCAACTGACGGCAAGCTTCAGCAGTTTTATTTGCCGGT
GAAGGCGGTGGACAAAGACCTGCTGTTGTACGCGCTGATCCGACTTGGTGTCGTGAGTGGCAAGGTGATCTTCTTCGTTAACTCGACGGATGCGGCGTAC
CGACTCAAGCTTTTCTTCGAGCAGTTCGTGATTAAGAGCGCAGTTCTGAACGCCAAGTTGCCACATAACTCACGCCAACACATTATTGAGGAGTTCAACC
GCGGTCTCTTCGATTACCTTATTGCTACGGACGATAGCGTAGATCGTGACGAAGTTGGCGACGAGGATGAAGACGACGAGGAAGAGGAGGATGACGAAGA
GGGTGAAGAGGGTAAAGAGGCGGAGGAAGAAGAAGAGGATGAAGATGCAGAGAAGTCAGATGCAGAATCTGACGCTGTGGAGGAAGATGAAGAGCAGACA
GTTGAAGATGACAGCGACAAGGAAAAGGAAGATGACAGCGAGAAGGAGGACGACGAAACTATGGACAGTGACAAGGAGGCTTCTTCTGAAAATGAAGACG
CTGGTGACGACGATGAGCAGCAGGAAAAGAAGACGGTAGGCGCTAAACGTGGACGTGCTGATGATGAGAGCTATGGTGTGTCCCGCGGTGTGGATTTCCG
CGGTGTTCAGTTTGTTATTAACGTGGACTTCCCGAAAAGTGTGCGTGCGTACACACACCGCATCGGTCGTACTGCGCGTGGTGGTGCCTCTGGTACGGCA
TTGTCTCTTGTATCCAAGGAAGACGCCAAGGAAGAGCGTGCACTGAAGCGCGTCCAGGCGAAGCAGCAGGCTGTCCGCTCCGAGGCAAATGATGTTATTG
CCCAACCCGCTGAGCTAGCATTTGACCTCAAGGAAATTGATTGCTTCCGTTACCGTGTGGAGGATGTTCGTCGTGCTGTCACACGCGTCGCTGTGCGCGA
GGCACAGCTGGCAGATGTCAAGAAGGAGATGCTAAATTCCGAGCGTCTGGCGGCACACTTCCAGGCGAACCCGCGTGATCTTAACATGCTTGAGCATGAC
AAGGTGGTGGGTTCTGCTTCGGTGCAGCCTCACCTTGCGACAATCCCTGACTACCTTGTGCCTATCGAGCTGCAGCCACCGGCACCAGCACGCACCAAGA
AGAAACACAACAAACATAACAAGCGACAGCGTCTCGCCGACGGTAAGCGCCGTACGGATAACGATCCATTGCACACGTTCATAGCTCCTGATGCCGATGA
CGATAAGAAACAAACTGTGGAGGACCGTATCAGCTATGGTAATAGCGGCGTGGGTAAGAGTACTGCTGGCCGTCAGAAATGGAAGAAGCAGCACCGCAAG
GGCCATTTCAACCCCAAGACTATTGCCAAGAAGAAGTACAAGATGAGCAAGGGCGCCACTCATTAAAGAGCTGAAACTTTGAGCCAAGTCTGCTGTTTGC
CTCGGCCAGCATCAGGTATCACGGAGCTTTGTTCTTGCTTTGCTTGCCAAATAGATACACGTTTTTGCTACGTTGATGGTGTGCTTGTGTGTTATTGAAG
GTTGCGGTCAACAGTCGAAGCGAATGCCGGCATTGACACGGGTCGGCTAGTGCCGAAGTAGCGAAGAGCTGCAGGGGGTGCATTGCTAGGTGGAACAAAT
ACTGCGATACTGTCTGGATCACCTTCTAGCTGCCGCTGGACAAGTTGGCGCCAGAGTTCATCGCCCGCAAGTTGCACCACTCGGTCAGCTGGGAGTTCTT
CGTCGGCTACAGCCACCTCAACTAATGCAGAATCTGCACGAGGCTGCAATGCATCGGCCATCAGCCGCTTCCGGTCGTATGCATAGTCCAGTAGTTGTAA
ACTGCGCATGTGCTCAGTATGTTCGCGCTCAACACGAGCAAGGCGTCGATGGTCTTCTTCGGTGCTAGCTGTCGCCCGCGCTGCCAGAATCTCTGGTGGG
GCAGAGAAAACTGTGCTCGTAGACGACGAAAGTGTGAATAGAGGCTTGTTACGGCGCACCACTTCCTCTCGGAGAGCCCGGAAATCACGTGACAAGTGCA
GTTCTTCTTTAGCAAGTGCCTTCATGGCACACACCTCTCGTGCGCGTTGTGCCCGAGCATCTTCCTCTATTGCTTGGCAGTGCGCTTTGTGGAGCTGGTT
CCAGTGTCGAGTCTGGTCGGTGCGAGCAATTTGCTTATCGAGTTCGTTCACACGATGATCACGTATTTCCTCATTGTGCACGTGGCGAGATATCATCGCC
ACACTTGTAGTGAATCCACGTGTCATCTCTGCGCTTTGCTGTCGTGCCCGTCGAATCAACGCCTCGGTCTCCTTTTTCTTTCGACGCTCCTGCACTTTGT
CGGATTTGAACTTGGCCACCGCAGCCAATGTTGCAGGATCGGGTTTGTTGTGTGAACAGTATTTTGCATGAAGCAATGCTGGAGCAGACGCAGACGCATT
GAGTGATGGTACTTGTGGTGGTGGATTGCGAGTGTATGCCTCGTAAGGAAATGTGCTCGTGGCATCACTTTCGTGCGCGAGCTGGTCAAATGGAGGTTGA
TTAGCATGTGTGGGTGACTGCTGACGGTCGTATTGCAATGGCAGTAACTTGTTGTGCTTCCCTTTTCCAGCTTTCATCGCGCACTGCTGCTTCTGCCAGG
TGGAGAGATTTCGCACATGCTCAATAAGGTATGTCTCGGAAAACCAGAGCTGGCATCCTTGAATGAAGTCGCTGACCGAGACTGTAGGTCCTGATGTTGC
CATTGACTCTGACAAAATACAAGGCGCCAGGCGTTGCTCCCATCGACGAAAAGCTACATCGTCTACTTCCAGTCCATGAAAACGAAGCAACGGCTTGATC
TGCACGAGCTTTATACGTCGAGTACACCGTACTTGTGGATCGAATGTCACCAAAAGTTTTTCACATGCAGCCATGAACACCAAGCGACGACTACCGGTGC
TTTGTTGAGCGTTTTCTAATGCACTATCAGATGATAACGGCAAAACGGAAGGTGGGAGAACTGCTAGCGAAGAAGATTTTGATGCGGGACTCTCATAGTT
TGGTAGACGTCTATCGAGCTGCTTAGCGTATGGCTGTGGACGTTGCAGCATTCGTTTTACTAACTCACGGTCGTGTATAATTGCGCCCAATGTTTTAATC
GCTGCAGTTGAGTGGGGCTGTACAAGTGGCACGGCCTGGCGATACAACTCAAGCATTTCGTCGTTAGGTTCGCGAGATATGGCGGAGCTCTCAAAATTGT
TTTCACCATCGCTATCAGCTGGATTGTCATCATCTCCCTCACTATTGTCAGGTCGAGATAGTTGGAATGGCAGGAGGTATTCCACAGAGGAATGTCTCGC
CTTCATGGACTTCTGGATGGCCTTCTTGCACTATTCCAACTATTTCGCAGAAATAGATCTAAGTACTAAACGGTGATTGGTCAGTTTTGTTGAAGTGGAG
CTACATGGATACATTTGGAGGGTGTATGTAGTCTATTCTACCAGTGTCTTCAAAGAAGCGGGTGTAATAAGGTAGAGTCGATCAGCATACTGTGGCGGAT
TCCGTAGCACATGTACACAATCAGCCCCGCACCCAGCCAGATAAGCACACCGATCCTGCGCGAAGTTCACAAATTTCAAGTTAGCAACGATAATAAACAC
TAATTTTCTCGTAAATCCACGTACCATCCCTCTCCAGGGATGCTTGCCACCATGTACACATTGGCAAGGATCCCCATGCATGGCACAAACGGTACCAATG
GGCATTGAAACGAAGTGGTGAGGTCACTGCTTATACAATACAAGAAGATAGAATTAACAAATCATCAGTACGGCAAAACAGGGTAACAATACGCACCCGA
GTTTACCCAGCCGGTAGATGTACACGAATGAAGCAATCACCATGGCAGCAAATACGCCTTGAATCGTCGACGGAAGATCGAACTCGAAAGAGAGCGATAG
AGCGAGACATGCTATCACGAACAGAAGAACACGGTGAACAACACCAGCTCCACTGAGACTCGGGCGCATACGCAATAGAAGCACCCCAGCATTAACAAAT
GTGAAGACTTGCAGTGTACCGCACGAAATCACGTTGGCCAGGAAATCAAGATCGAAGACGAACGCAATCGAAGCAACCAGGACACCAGTAAATATAGTAC
TGGCAACTGGAACATGGGTTCGGTGGTGCAGCTTGGCGAAAAGTGATGGCAACAAACCATCCTTGGCCATCTGATAGAAAATACGCGGTTGACCCATGAG
GCAGGTAAACGCCGCAGTTGTAAGCCCAAAAATGGAGCCAAATGACACAATCCTTCCGGCCCATGGTGCATCATGAAAGGTAAACGCATTTACCAGCGGA
ACGTCACTACCAAGGACATCAATGGGTGCCATTCCGGTCACGACAAGCGAGACTCCAACGTAGATGGTCATTGAGATCAGCAGTGAACCAATGATTCCCT
TAGGTAGCGTGCGTTGGGGCTCGTGCACTTCCTCAGCTAGGCAAGCTACCATATCAAATCCCAAGTACGCGAAAAAGACCACACCAGCGCCTGTCATGAC
GCCATGAATCCCGGCAGGCATAAATGGCTCCCAGTACGTAACATCCACTTCAGTGCTTCCAAACACGACAACAAAGAGCAGCACCGAGATGTTCAACAGC
GTCACAAATGCATTGAACTTGGCAGATTCCTGTAATTGCACAACACAATTCCACAATTTTATTAACCACTAGTACAACCTTTTCGTCCACACGAACACGT
ACATGAACACCAGCAAGAAGAATTACAGTGCAGCACATGATGAGAAATGCGGCCAGGATACTGCATGACATGCCAAGAACCTCGACACGGACGAGCCACT
GCGGGAGGTTAAGACCCAACTGTTGCAAGAACAAGTGCGCATATGAGGCCCAACTACGTGCGATTCCAGCTGCACCAACACAAACTTCATGAGCCCCAGC
ACACCATCAATCTCATCACTACATATTTACCTGCCGAGATACCGTAACCCAGTGTCAGGTTCCAGCCAATAAGCCACGCAGCCAACTCTCCAAAGGTAAT
GTACACGAACGTATACGCCGAGCCCGTGACCTTCAGCCACACAACGTTAGTGTATCCTATGCATTCATCATCGAAAACTTGCAACGTACAGGCACGCGAG
CAGCAAATTCCGAGTACGTGAGCGACGTGAAGATGCAGGCAACTCCACTAACAAAGAACGATAGGGAGATGCTCGGGCCTGCGATCTGGGCGCCCACACC
CACGAGCGAGTAGACACCGGCACCTACTGAGCAGCCCACACCATAAGCCACCAGGTCCACCAGCGTCAGACACTGCTTTAGCGAGCTAGGACCAAGCTCA
CAACGGGACAGAGGCTTTACACGCCCCGCAGCCTCCAGGAATCGGTCCATGGTAGAGACACAAATGAGTTGCGCTGGACTTGCTCAGCTGCGATTGCTAC
ACTGTGTCCCTACGTACGTCAGATTCAACTTGGACGAGTTTTAGCCAATTGAATTCGTAGTTATTTGTGATTGGTTGAAAGTAATCAATATCCAAAGGGG
GAACTTCATACAAGAAAGCGAGTGAAGATGGCGTCTGTCCCGACCGAAGATGAGCGCACGCAAGTGCTAAACGCGTACAAGGCCAAGGTCATGGAACATC
GCGAGATGGAGAGCAGGTGCGTTGCTCTTTTTACATGTAAATAACGTCATCTAGATCTTCCTATTTGCTACGTGAACTCGCTGTGATCTTTCGTCATTTT
CGTCATTTTCGTCATTTACTTACCATTACATTCCTCTTTCCAACGTTAATCAGAGTGAAGAACATGCGCGAGAATGTGAAGACGCTAGTGAAGGAGTTTA
ACAAGACGGAGGACGATCTCAAGGCGCTGCAGGTACGGAATTAATCCATGAATTACGTATATTCGCCTGGATCTCTTACTATTGGCATTATGACTCAGAG
CGTAGGCCAAATCATCGGTGAAGTGCTGCGTCAGCTGGACGAGGACCGCTTCATCGTCAAGGCGTCAAGCGGTCCCCGCTACGTCGTGGGATGTCGCGCT
AAGGTGGACAAGAGCAAACTTAAGTCTGGCACGCGCGTGGCACTGGACATGACGACGCTCACCATTATGCGCTACCTCCCACGCGAGGTGGACCCAACAG
TGTACCACATGCTGAATGAGGACGCCGGCAACGTGTCGTTTTCGAGCATTGGTGGTCTGAACGAGCAGATTCGAGAACTCCGTGAGGTCATTGAGTTGCC
GCTCACCAACCCCGAGCTGTTCCTGCGTGTTGGTATCAAGCCACCCAAAGGTGTGTTGCTGTACGGCCCGCCTGGTACGGGTAAGACGCTGTTGGCGCGT
GCGCTGGCGTGCAACATTAATGCAACCTTCTTAAAGGTTGTGGCTAGTGCCATCGTGGACAAGTACATCGGTGAAAGTGCACGTGTGATCCGCGAGATGT
TTGGATACGCTAGAGATCATCAGCCGTGCGTCATCTTCATGGATGAGATTGATGCCATCGGTGGAAGTCGTTACTCGGAGGGCACGTCTGCTGATCGTGA
AATTCAGCGTACACTGATGGAGCTGCTGAATCAGCTTGATGGTTTCGACGCTTTAGGACAGGTGAAGATGGTCATGGCTACGAACCGACCGGATATCCTG
GACCCTGCACTGCTGCGTCCTGGTCGTCTCGATCGTAAAATTGAGATCCCACTGCCAAATGAGGCCTCGCGCATGGATATTCTCAAAATTCACTCCGGCC
CCATCACCAAGAAGGGTGAAATCGACTACGAGTCTATTGTCAAGCTTACAGATGGCTTCAACGGTGCCGATATGCGCAACGTTTGTACTGAGGCTGGTAT
GTTCGCTATCCGTGCTGACCGTGAGTATGTTGTGGAAGAGGATTTCATGAAAGCTGCGCGGAAACTGGCCGAGACCAAGAAGCTCGAATCCAAGATGGAC
TACAGCAAGGTTTAAATTTGCTCGCAGGTACTCGCTGTGGGCATTATTGTCTGGCGCTGGTGTGCGTTTTCCGTGCTACTGTTGAACCAGTACTAGTGGC
CGACCAGGTTGGACAGATACAAGAACATGGAAAATGAACACTACGTGGTGACTGTATCTTGACGTGACTCCTGTATTGTGGTGCTGATGACATTCTATTT
GATGCGATGCTATTGTAGAATGTTTTGTTTAGGTAGTTGCTGTTTCAGCACAAAACCGCCCAAGGTACGACGTTAATGAATTGTAGTTTTCCCGAAGCAG
CAAATAACATGGCAACGGCTAGCGGAAATGGAATGGAGTGCTGCGAGTTGGTGGGCCTTATGGGTGACGTAGCTTACCAGCGCTGTAGAATGCTACTCCA
GGAGTTGCGCGAGTTGCACCCGATCTTCGTGTCACCCCTCAAGGGGATGATGGAAGTTGAATATCTCGAGTACTTGCAGAACCAGCAAGATAAAATACCC
AAGCACAAGCGCGCCGAATTGCTGCGAACGACTCGACCGATCATTCTACTACTAGACTCAACAAATGATATGCTGGACGGAGAAGACGAGCTGCTTGACT
TTGCAATGGAACGGACGCAGCTTTCGAAGAACGAACTGCTAGCAGGGGCTGCGTTTGGTAGTGTTTTGGTCGGCAATGATGCTGAAGGCAGTGATAGCGC
CCGAAACAAGTATAGTGAGCAACTAGCACTAGCAGAAGAAACATTGGAGGCAAAGGCGGAGGAAGCCGCCAAGCAGGCGTTGTCACATTATCGCGAGCTA
TCCGGTCACCAATACGCCTTCTTAGTCTTTGAGGTCGATGGTGTGGCACTGCCCCGGGTAGAACTTGAGCTATTCCAAAACGTGTGTCCCAAGACGTGCA
AGAACTTTTTGGCATTCTGTGAGCACAAGGTTCCCGATGTAAACGATGAAACTCAGCTCCTGGGCTATCCGGGGAATCCGGTGCATCGTGTAGTGCGTAG
TGGCTGGATTCAAGGTGGCGATGTCTCTGGTAATGGCCGAGGAGACGGACCTTGTCGATCTGTTTACGGTCTAGAGTTTCCCGACGAGAGCTTTGCTATC
TCTCACAACGCAACCGGTATTCTTGTACGTCTGCATGTCTGCAGGAAGTGTTATCACTTCTCATTACCATTCTTGTTGTGCGTTTGTTTTCAGTCCATGG
CAAACACTGGACCACACACGAACGGCTCGCAGTTCTTCATCACCCTCGCGCCGCAACCATGGCTGGACCGCCACAAAGGTGAATATTGGCATGTGAGTTC
AAAATCTAATTCTTGAACTAATTCTTTTGTGGTTTGGCTTGTGGCGACGTTATTCAGTGGCATTTGGTCGAGTGGTGAGTGGCTGGCGTACTATCATGAC
TATCGGAGGCCTGGAAACTCGTCAAGAACGACCATGCGTACCCTGCACCATTGTTGACAGCGGAAGACTTCAATAACGGGCTTGATGAATAAATAATGCT