Description :
From Genome Similarity Track
Location :
contig_24:607120- 634240
Transcript NameFunction/comments
g4644.t1hypothetical protein F442_07837
g4645.t1hypothetical protein F442_07840
g4646.t1hypothetical protein PHYSODRAFT_506882
g4647.t1hypothetical protein
g4648.t1hypothetical protein PHYSODRAFT_508617
g4649.t1hypothetical protein
g4650.t1hypothetical protein PHYSODRAFT_560567
g4651.t1hypothetical protein
g4652.t1hypothetical protein PHYSODRAFT_560568

Sequence
27120 bases(100 bases per row)
GATGGCGCGCTGCATCTCGCCCTTGTTGCAGGCCAGCAGCGCCGCCATCACCGCCTTGGCGTTCTCGTCCTTCACCGCATCGTTCTTGGACTGCAGCGGC
GGGTCTTCCAGGGCTGCGCGCACCGCCTCCTCGTTCTTGCGCTGGGCCAGCAGCCCTTGTACCTGTGTGGCGCGGGCCTGGACGCCCGCCGCGATCTGAG
TCTCGTTCACCGCCATCTTGCTCCTGCTCTTTTTGTATGTGTCGCAAAGGACCGTGTGCAATTGTCACCAAACTTGCCAAATCCGGTGATCGGCTTTGAC
GGGGAAGTGAAGCGGCTTCAACTTGACCTTATTATCAGATTTCGCGTGCATTGCAATTCGGTCACAAGGAATTGGGAGTGATATTACAGTAAATAAAGGA
GGAGGAGCTCTGGAAGTGGAAAGGTAAAAAGCTCGGTTGGAATCTGCCATCAACTTGCTGGCCAACGCATTGCAGCGAGTTTACATGATGCTGCAAAAGA
TCGGAATCGGCAAGACGCTGTATGAGCGGCCACTGCTGAACACGCCAGCAAAGCAGAAGGAGAGCCCAACAACAAAAATCGTCAGCACCTACCCACTGCA
AGTAAGCAATCAATACCCAACACGTACACGATCACTGGTCGGCGGTGTTCCATCAGAATCTGGTTCTGTGCGCCGCACACTGTGCACTGGAATGTCGAGC
CGTGGGTCACGTTGCGCACTACATGCGTCGTACCACAGTTGCCGCACTTGTATGGCATCTCAGCTGCGGGACTGCCTGCGCGACCGCCACCATCGGATCC
TGGTCGTACTGAGTCTGCAGCTGACGCGCCACCTCCTCGTCGCGGGAAGTGTCATTCTACAGCAGATAGCAACGTCCATAGCGTCAGCTCCGAGCCCGTC
GGACTCAACCATCATTGTCAGTTACCTGAATATTCATCGAGACCTGTTGGGCACGCGGGATCTGTGGGTACAGAGGCTTGTCGCCGCCTGGAGTCGCCAT
GGTTTGAGTCTTCTTTCTTGGTCTCAATTCAAGTCGCTTTGGACTCAGAATTTCTTCCTTGCGACTAATAGCCAATCAGATCTTGAGATGCTACTGACGG
CATATCCCAATCAATTTGTAGCAGAGACGATGGGGTTGCTAGAGCTGCTGGGGCAGGTGGAGCGCTGGGGGTCAGTATTGCCCTCGTAGTGGCAGTACTG
GGAGGGCTTTATCTGTGGCAGCAAGCGGTGGGGGTGTCGGGATCACCAAGATGCTGCGGGACTTCAACCTCGTGCGCGTGCTCAAGCGCACGGACACGGA
GCTGGCTACTGGGCAATTTCAAGAGCGACAACCACAAGAAGGCGGCGGTGCTGATCATCCAGACGGCGGCGATGGATACGGGAACTTTGGGTCAGTTGTT
GACGGGGCTGTCACTGCATGAGATTCTGGTGAACGACATCTACAGCACGTTCCAGGGAGACGTCTCGCGCGATGTCAAGCCGTACAAGGTGGTGATGCTG
AGAGGGATGAGAGAGGGGGGGGGGGGGTGACGGTGTAATTTACATTGTTTGTGCTTTTGTTTGTTTGTATTTGGCTAGGTAAATTTGATCTACCCGGCGA
CGGATCGACATGTGCGCAAGCACACAGACCAACATTTCCACATGGTGGTGGAAACCAAGGACGCGTATCGGATGATCACCAAACCGTTCATTGACAGTAT
CCCTGCGGAAAATATTGAGTGGGTCTACAATATCCTGGACCAGTAAGTGTGCTGGAACTGCTGCTCTGGTGCGTGCTACGTTGTGTAGCGTATTGACCGG
TGTGTGTGTTTGATGGAACAGCAAGAGCGAGACGGAGCGGATTATTTACGAAGACCCACACCATCGCAATGGGTTCGTTTTGCTTCCCGACTTCAAGTGG
TCGGACCCTTCCAAGGTGAGTCCTGCGTTCTGTAGTCTGGTGCTGTCAACACAATAACCCCGTGATGCATGCTGACCGCTGGCTCCTACGTTGACTTTAG
TTGGAGTCACTGTACTGTTTAGCCATTGTGCATGACCGCTCGCTTCGATCACTTCGCGATCTCACTAGTTCACACTTGAAGTTGCTCCGAAACATCCGGT
AGGCTCAGTTTGTTATCAAGTTTTTTTTTGGATCCGGCAAAAGCTCACGTTTGTCTGTTAACAGAAATGCAAGCTTGGAGGTCTTGAGCAAGAAGTTTGG
CGTCAACCCGAGCTCAATCCGCATGTACTTGCACTACCAGCCTACGTACTATCACCTACACGTGCACTTCTCGCACGTCAAGATGACCCAGGGTATGTGG
ACTCATTATCTCCGCGTCTGCGTGGAAACTAACATTCTATCTACAGGAACGTTTTCGGGCAAAGCTGTGCTGCTTGAAGACGTGATCTACAACCTGTCAG
TCAATAGCGACCACTACAAGAACGCGACGCTGTCATTTGTGGTCGGTGAGATGCAGCACAAGCGGCTCTTCGAGCTCTTCCGCGAGAAACACATCATTTA
GTGCAGGCCAGTGTCAATCGGTGCACTCTCCAACGTGCTTGCAAAGCATAACCCTTTGCAGGCTCATTTTGCGTTGGTGCGCATACTTAGTAGTTGCTAT
GAATGGAGCATTGTAGACGAACGGGTGCCTCATCTTCTTCATGGATACACTCGCCTTACAAATTCCTTGTCTAAATCCAACGGCGGAACGCACCCCTCCA
TCGGCGGAAAATAACGGCCGATGTTCTCAGTGCTGAATTCGCTCCCGACCAGCAGAGAACAAATCCCAGCATGACTCTCCTCGAGAAGCTTTTGGGCGCC
ACGTTGGTGTCGAGGCGCGGTGAGACGTCCACGCACGAGGCGCTAGCGCACAAGTCGGTGGTGGGGTTGTACTTCACCGCCAGCACGTGCCACCATGCCG
AGCCTTCACGCCCGTGTTGGCGACTGTGCACCGTAACATGACGCTCAACGCATACAAGATGCTGCCCATGAAGGACCAGCTGGATGTGGTGGTTCTGTCC
GTGGACCGCAGCCCCGTGGCCTTCCACGACGCTCTTCTGCAGACGCCGTTCCTCGCCGTGCCATTCCACCGTCGTGAAGTCGTGCAGGACCTGTGGAAAC
GATACGACGTGAAGAAGATCCCGGCGCTTATTTTCGTGGACGCCAACGGCGACGTGATCGAGCGCGAAGGCCGTCGCTTCGTCGAGAACAACTACACGGA
CCTGCGCAAGATTTGGGAGCACCTCGCGCCTTCTTGCTCGTCGTCGTCGGGCCCGGAGGCTGCCAGGCCGTGATGTTCGCTTCTAGGAAAATTGCATACC
CCATCTACCGCGATAAGTACCAGGTTAGGCTCAGTCGATTAAGCTTTTCTATTCTCTTTGCTTCACCTTCGTTTTGGAATGCTGCTTCATGGCGATCCGC
TACACTACCGGTAGAGCTGCAAGGTCCAGCTGTAGGTGCCAGAGTGCGAGATCCTAACGCTCTTGTAAGGTGGGTGGTGGCGTGTTTGCTCGGAGTCCAT
GTGGAGCATTTCACGGTCTCACCATACTGCAAAATTACACATGGATCGTGGCGTGGTTGGTGACATGCCGCTACAGGTGTAGTCAGACCTACTGGAAGCG
GATCCTGCATCTGAAGTAGATAATCGTAGGCAATTGTTTATACTATCGCTTGAGGCTGAAACCACTTTAACAGATACCATTGCAACAATTGACGGAGAAG
AAGCTTTATCTCTATGGTATAGACTCTTCCTGCAATGCTAAGAGAGCAATGCCGACGGCACCAAACCCATAAGCCATGTTGAAGTCTGTTATAATTCCTG
TGAGCCAATCGCAACATTTTACTTTATCGACAAAATATATTCATCCAATCACCGCGCGAGTAGGCAGTACGTACTTTAGCCGTTGTACACGCATCATGTC
GCTGAGGCTTCCCACAGCGCTGAATCAGCAGTCCTCCGTCGGCGCACTCTGGAATTGGCGGCACCACACCCAAGGCATTGACACCAGGAGTGTCGAGTCC
AGCCATGCCTCCTATCTCAGCAACCAGCAAATCTCGCGGCCCTGTACTGGCCAAGTCCGTGGACGAAGACGAAGTCTATGGCACATTCAACGGCCGACCG
CTTCAAAGCACAAACATTCGAACATCCAGCAATGGTTCAAACTCCAGAATCGGTGCTTTGATGCGTGCTATTGCAGCCGTGGGGTTCGTCCTGTTGGCCG
CAGGATACATCACCAATTCCGACTCCAGTGCCGTCCAAAAGGTTGCCGAGTCCTCCACAGTCAATGCAGATACGACGGAAGTGCCGGTGACCGACTTTCA
TCAGCAGTTTGTCGACAACGTAAACGCTGGCAGCATGCGCGAGTACCTTCACACGTATTCGAGTGTCCCGCACAGCTGCGGTACCGAACAAGACTACAAG
ACGGCGCTGTTCACGGCGAAAATGTTCCAGTCTTTCGGCATCAAGGCAGAGATCAAAGAGTACTACACGCTGCTTTCGACACCGGTTCGTCGTCACTTGT
CGATCGTAGAGCCTGTTGAAGCTGCTCGCGAGCTGAATTTGACGGAAGCTTCGGTGCCGGGCGATACGTGCACGAGCGATGATAGTGCGTTGCCTCCATT
CGTGGCGTATGCTGCGACGGGAAACGTCACGTCCTCGATCGTGTTTGTGAATTTCGGCAAGCAAGCAGACTTTGAGTGGCTTGTGGGCAACAATGTCACG
CTCGAAGGTAAAATCGCATTGGTGCGATACGGTGGTAACTTCCGCGGACTGAAGGCTATGGCAGCAGAACAACATGGAATGGTCGGTGTGCTAATCTACT
CGGATCCCAAGGAAGACGGCTTCGTTCACGGCCCAGTGTACCCCGACGGCCCGTGGCGCCCTGAGGGATCGTTTCAACGTGGTTCGCTCACGTACCTTTC
GCTCGCTGGAGGTGACCCGATGACGCCTGGTTGGGCCTCTACGGAGGGCTCTTACCATATTCCGTATGAAGACGTGAAAACAATTCCCCACATCCCCGCG
CTGCCACTATCGTATGGTCAGGCGCAATACATTCTGCAGGCTCTGGGTGGCAGGGAGGCTCCAGCTTCGTGGCAAGGAGGTCTCTCGTTGCCTAACGGCT
ACCGTATTGGTGATGATGAGGCGATGGTAGTAAATCTGGACATTGAAATCGATAACAAGGTCGGGCCGATCTGGGATGTCATCGGTACAATTGAAGGCTC
TGAGGAACCTGAGCAGCTGGTGCTGTTGGGTAACCATCGCGATGCCTGGGTTTGTGGAGCAATTGACCCTAACAGTGGTTCATCCACTCTTCTCGAAATC
GCACGCGGATACGGCGAGCTGCTCAAGCAAGGATGGAAACCACGGCGTACATTGATTTTGGGCTCATGGGACGGCGAAGAGTATGGCCTCTTGGGGAGTA
CCGAATATGCTGAAGAAAACGCTGAGCTCTTCAAAAAGCAGGCAGTGGCATACCTGAACGTGGATTCTACGATGGGTCCGTTAGTCAGCGCCAGTGCTAG
CCCAGCCATCGCGGAATTTCTCTACCAAACGGCCAAAGACGTGCCAGCAAACAAGTTCCATGGCAACGAAACGGAGAAAACACTGTATGAACAATGGACT
AAACAAGCTGCGGCTCATCGCGAACAACTTCGCGGGGCAGTGATGGGACACTCGGTCCAGAGCATTTGATCAGCTTCATGGGTTCTGGCTCGGATTACAC
GGCGTTTTACCAGCATCTCGGTATCATCTCGGCCAATTTGGGCTTCTCGCTCGCGCGGGCTCCCTACGGAGTTTACCACAGCTCGATGGACAGCATCATG
TACTCGGAGTTGTACGGCGATCCTAACTACGCCACCCATGTCGCCACTGCGCAGTGGTGGGGTCTTCTAGGCCTGCGTCTTGCCGACGACCAGGTTTTGC
CATTCGACTTCACTACATACGGGTTCGTCATGGCGGAAGACTTGGCAGGTCTAGAGCAGCAGGTTGCCACGCTGCCGCGCTCCAGTGTAGATTTCAGCGA
GCTGCACCAGGCCATTGATCGATTCACCACCAGTGCCACCACCTTCCACGCGCAGCTTGCCGCGTTCGCGTCCAACGAGACCCTTGCGGGCAACGTTGAT
GCTCTCCACGCGTGGAACGAAAAGTTGCTGCTGCTAGAACGTCACTTGATCACCAAGGATGGTCTGCCTCACCGTCCGTGGTACAAGCATGTGATCTTTG
GCCCAGGGTTCTACGAGGGGTATGCCGGGGCAGCTTTCCCGGGCATTTCGGACGCGATTGCATTCTATGATGACGCCGCTACCATCCAAAAGCACGTTGA
CGACGTGGCTCGCATTGTGAACGACGCTGCTAACTATTTGTTGTAGACATTGAGAGCAGCAGTGTGGTTTACAACACCAACAAGTTCATCTCTTTGAAAT
CGTTGTTCTCGAGGTTTTCTAAGACCAACCGACTAATCGTCACACGTCGAAAATATGTTCATGCGGGTCATGGAATTGCTGGGGCAGTTGGAGTGTCTTG
AGGTTGGTGTCGCGCTGGTGGTAACAGTGCTGAATGTCCTTTGGCTATGGCAGCAAGCAGGTGCAAGCACCAGCTCCAAGCGGCTGCGTGGTTTCAACCT
CGTCAAGACAGACACGGAGCTGGCGCTGCTTGGGACCTTCAGGAGCGACAACAACAAGAATGAGGCGGTGCTTGTCATTCAAGCGGCGGAGATGGACACG
GGCGACCTGGATCGAATGCTAGCAGGAATGTCATTGCATGAAATTATGAAGAACGACATCTACAGCACATTCCAAGGAGACGTATCGCGCGATGTCAAGC
CGTACAAGGTGTGGGCCGAGAAGAATCAGGGAAATATGTCGAAGTACAACGTATTGTGGTAATCTGTTTTGCTACACAGGTTAATTTAATCTACCCAGCG
ACCGAGGCACACGTGCATAAGCATACCGACCAAGGCTTTCACATGGTGGTGGAGACGAAGGAAACGTACCAGACAATCACGAAACTTTCGTCAACAGTAT
AAGCTCGAGTGGGTCTACACCATACTGGACCAGTAAGTGGGGAGAGAGTTTGATATTTAGAGTTAGCAGTAAGCGTGACGTATTGATCAGTGTGCTTGCT
TGATGCAACAGCAAGAACGAGACAGAGCGGATGATTTACGAGGACGCAAGCCCTCGAGATGGATACATCTGGCTGCCAGACTTCACATGGTCGGATCCGT
CCAATGTACGTCTTACTTTGCAGTTTGCTGCTGATTATTTGATCAATACGGACAGTTTTGATGATTTGCTTCTTTCTTCCGACACAGTTGGAGTCACTCC
ACTGCCTTGCAATTGTGCACGACCGTTCTCTTCGATCTCTCCGTGATCTTACCAGCTCTAATTTGAAATTGCTGTGGAACAAATTCGGTGCGGGCCAACT
CTTCCCTTTACCTCTGTGGTGAGCTATTATAATTCTTGCACAAACTCATGTGCACCTTTGTGTGTTCTTGCAGAGAGATGCGAGCTTGGAGGTTTTGAAC
AAGAATTTTGGAGTAAACCCAAGCTCGGTGCGCATGTACTTGCACTATCAACCGACGCACTACCCACCTGCACGTGCACTTTTCACATGTTAAAATGACT
CACGATACACTTTCGCTCCACCGCGGCTTTCAGGGCTCTTGCGATTTATTGTGCGCAGGAACATTTCGAGCAAGGCTGTGCTACTTGGAGACGTGATCTA
CAACTTGTCGGCTAACAGTGAACACTACAAGAACGCGACGTTATATTTTGTGGTCGGCGAAATACAGCATAAGCCACAGCTCGAGAAAAGGGCATCATTT
AGCTAGCCAAGCGTCCGCTTCATTCATACTAGTCAATAGTGTAGCCATATCTATTGACTTAAATGTACTAAGCTTATTAATAATTAAGCTTGCCAATGAG
TCATACAAAAACGTAACGAAGCTCAGCTGCTGTTCATTTTGTAAGTTGAGTTGAGAGTCCCACCATGGATACCTCTGTATTGGCGCCTGCAACGCAAGAG
GTTTGCTTACAGCTCTAGCTCTAAATATTTGATACCGTATGCACACTACGAGTGGTTGACTAACGTGCTACGCCGTCGTTGTTACCTTCAGGTGCTCAAC
GATTTACTGACCGAACGCGGCCTCACCGAGTGGCAAGTCGTGTGTGACGTCCACGTCTCCGTCGAGCCCAACGAAAGCATCGACATAATCTACGGTTGCG
CATTGGCGACAAGTCTTCAAGAAGAACGCATCGATCGCAAGCGCAAGCGGAAACCGGCCAATGACAGTGAGCGACCGGCGTGGAGCTGCTTCCTCGTGCT
CCAAGCCGTCTTCTGCTCCCTCAGCATCAAGAGGTGCGTCAGCTGCCTACAGCCCTTCTCTTGTATTTACTACAGACCGTAATCTTGGTATTGTTTCTAT
TGAACGCAGCCTTCTAGAGCTGCAGCAATGCGCCGACGCCAATGAACCACTGAGCACGGTCTCAACAGCCACGAAGCGAACGTTCCTGTGCCTCACAAAC
GCCGCAAGCGTTAGGTATGCCCCCACTGCATTCCACAATGAATATGCTGCTGTCTGTGCTAACCTACGGCCCTTAATGCTGCATGGACGCACTCGCAGTT
ACTACTCGCTCCAAGCTCCAGCCATCCTACCCTAGGCGTCGTCACTACCTCTTTATAGTGACATAATACATTTCATCAGTCAATGGTTGAAGTTCATAAC
AATGACCTTCTAAACGGTTTGCGCAGCAGGAAGCGTGGAGCACTTCAGCTTTGTCCTGATACGGTCCGCACCTGCGTATCCGTCACCTTACGGCGTTTCA
ATGCGTCTCCCAATGCTCTTCACGTTACCACGAGGCTCCCTGTTGAATACAGGACGCAACAAGCTGCAGGGTCGCTGCGTGACGACTATCGCCACTGGCC
CGTCGTCTTCGACAAAGAGAGACCGTCCACTACCCCTCGAGGGCATCCGAGTGGTGGAGTGTGGCCACCTCATTGCAGGCCCCTTTGCGGGTACAATTCT
GAGCTACTTTGGTGCAGACGTAATCAAGGTGGAGTCTCCCACGGGAGATCAGGTACGCGACTATCGTGAGCTGGACTCGACCAAGACGTCGCTGTGGTGG
TACTCGCTTGGACGCAACAAGCGCTCGGTGTCCATCGATATGAAGAAGGAGGAGGGTCGGGAGTTGATCAAAGAGCTCATCGAGCAAAGCGACGTCTTCA
TCGAGAACTTCAGGCCTGGCCGCATGGAAAAGTGGGGGCTTGGGCCGGACAACTTCGAGGAAAACAACCCTGGACTAGTGTACACTCGGGTGTCTGGATT
CGGACAGGACGGTCCGTACTCGTCCAGACCGGGCTTTGCGTCAGTGTGTGAAGCTATGGGCGGCTTTCGCTATGTGAATGGCTTCCCGGATCGCCCACCT
GTCCGCCCGAACCTCAGCGTTGGTGATACACTGGCTGGGATCCACGCGGCTCTCGGCATTGTCATTGCTCTTCTTGGCCGTGAGCGCGGTGCCGCTGCCG
GGCTGAACAGCAAGGGGCAAGTTGTGGATGTGGCTATCTACGAGGCAATGTTCAACCTGATGGAGGCTGTAGTTCCAGAGTACAGCTATTCGGGAAGTGT
TCGTGAATGTTCGGGGTCAACCATTACGGGTATTGTGCCTTCGAACACCTACGTCACCAAGGACAAGAAGAACGTCGTCCTCGCTGCTAACACTGACTCG
CTGTTCGTGAAGTTGATGAACGCTATCGGGCGAGAAGATATGGCGGCGGACAGCAAGTACCGCACGAACGCCGACCGCGTCGTTTACCAAGCCGAGATCG
ACGCCGCAATGGTGGCCTGGACCGCTACCCAGGAGCTGAACACGGTGGTTACCGTGATGGAGAAGGCCACTGTGCCTGTCGGCCTCGTGTACTCTGTGGA
GGACATGGCCAAGGACCCGCATTACCAGCACCGTGGAATGTTCGAGGAGGTCGAAATCCCGGACGGAGACGGCACGCGCAAGCTCCAGGTGCCTGCGATC
TTGCCAAAGCTAAAGGCGACGCCGGGTGAAACGCGGTTCGCTGGTCGCAGACTGGGGCAGGACACACGTCAGGTGCTGGAGCATGTTCTCGGGCGGTCCC
AGCAGGAGATCGAGCGGCTGCTGGGTGAAAAGGTGGTGTTTGAGCCGTCTGTGTAGGCGTGTCAGAACGAGGCATAGGGCGACAATGCAATCGGTAGACA
AACGTTTGTGAATCACTCGCTGACAGGATTGCATCGTATTGGTATACGGTACTCCGGAGCAAATGGCAAGAATCACGAGAGATCACCGCGCTCTATCTAC
ATGTACGTGGCCAGGTTTGTAATAAAGCTCTTCAATCGATAGGCATCCGCATCACTTGGACCAATAGCCTATCATTGCTGCCTTTGCCAACTGCAATTGC
ATCATGGCCTTTGTATTCGAGAGAGGACTCGCGCTCAATGCAGCGCTGTCCTCCCACCCACAATAACACGATGGCAGTCTGGTAGTCGCGCAACGGCTCT
GCGGTGTTCATCACGTCGAAATGGCTCGGCCTCCGACGGCATCCGCGTTGTGATGCCGCTTGTCCGCTTGTGACACAAGCTGTGGTGCCGCACCTGGCGC
GGGAAAGAGGTGGTCGCCGTGTTGCCGCCTTCTCTGCACAGCCAGGCCCACAGCCGTCGGACAGCACCACGGGACTCCAATACGCTGCAAAAAGGCAACT
ACTACATGTAGTTTTGATAACTGCAGTCTACATACATGCACTGGTGCCCTGCAACCTGGTTCAGCCAGCGGATTCCCGGCTCAGAATGGCACCAGGTGAT
CACGCCCCGAGGCTGGTCGTTGTTAACGCCAGATGGAGCACCCGCAAAACCGACTCGATTATCAGTTATCGCAGGTTTCATCCTTCGGTGCAAGCGATTA
CGCGGGGTATGCACTTTACACACACTTTTCCGCGCATAATCCCTGCTAACCTCCGTCTAACAGACAACATACCGAAGGCAAAGGCAGCCGAGAGACCGCG
CCAGCGTCTCGCGTCCTGCCCCCTTCCTAGGCCCGACATCTCCGTCTCCTTCTCCCATACCCTTGCCACCTGCTTCTCGAAGCTTTGAGCGCGTCGCAGA
CGAGCGGTACGCTAGCTCTCGCCCCAAACTTGCTCCGCGTTTGCACTCATTGTTCTGTGCTCCCAGAGGCCAGTGGAGAGTCCGAGGACCTTCTGCACAC
ACAGAGGCGGCCGTCCTGCGCCTACATGGGATGCCAGCACCCGACGACGCGCCAAGTGAACAGACCGCAGCCGCTAGGACCAACAGCAGCGGCTACGGCC
TCCGACCAGCGCCCAGCTCCTCCATCTCGGGCCTCGGTAGCGTAACCAGCTTCAGGTCCAGCGAACTAGACGCACAGGAGGTGGACGTGGACGAGGAGTG
CGCCGACAGCGACATCCTCGAGGACCCGAACGACGGGGAGATGACCATCATGAACGACGACGACGCCGAGTTAAGCGAGGAAGAGGAGGAGGTCATGGAG
CACTCCATCGACTTCTCCGTCAACAGGGCCACGGTCACACGCGCGGGCGTCATACCGTGCTGTGTCTTTGTGGGAAGAGTGAGGTGGGGCACCACGGACT
GGGAGATCTACTTTGGCCAGAAACAGCTCCTACGGCTGCATTTCAACCTGCATCTCTATTGCCTACTTAACCGACACAAGGTGATGCGCGGGGTGCATCT
GCCGTGGACGATTTGGCGTGAAAACGAGCGGAAAAACGCGTGGCCGATGTGTACGTGGTACAGGACTACATTCGGGGACTGCTGAAAGACAGAGACTTGC
GCAACTCAGAGCCGTTGTTGTCCTTCTTGGAAGTCAGTCCGTCGCGCGCAATGTTGCGTCTTGGACCTTCGCTGAAGGAAGGGTATGTGCACATGCGCAT
CAACGGACCATTCCAACTGCCGCTGTACACGTGCTTTAACCGCACCATCGAGGCGCTGTACCGGCATCTGTACCGCGCGTGGATGCGCATTGCGTTCGTG
TCGGCAATTGTGGGGTTCATTTTCCCCGTCTTTCTTGTGATCGTCACTAGTCTTCCGACGTTTTTCTCGCCGCAGAAGGAGCTGGTGAACTCGGATTCCG
GCACCAAAGAGGTATCCACGAAACTCAACACGGCTGGTGTGTTCTTGGGTCTAGCTGTGCTGGGAGGCATCTTCTTCTTTGCTGGATTCGTGTACAAATT
CTTCCAGCATCGGCTTGGTGTCATTCGGCGATGGGTCGTGTTGAAACCTTCGTGCTTCGCGGCCGCCTATAGGAATCGAAATGACCGTGAGCCCAGCGAG
GTTTTCTTGTTCGACAAGACTTTCACAGCAAGAAAAGGAAGCTACAGACAAGGTGTAAGCTGGATGCCAAGTGGACTGGTTGTTGGAAGCAAGGCTGGAG
ATATCGAAATTGACACGGGGCACTACTACACTCGATTAACAGCTTTCGTAGCTTTGATGGGGGTCTGCTACGGAATCATGCGTCTCTCGAATAATATCTA
CGATTTCGAGAACCTTACTCTGAACAAGAGTCTAGGCGTTCCCATTGCAAACGCGTCAGGTTATGAAAATTGGACGCAAGGCAACGACATTGAGTACTGC
GGCTACTACTTCACCGTGCCTAACGGTGTCACGGTTTACGTTGAGAGTGATGACGACGGCGCAGTGATCTCGCAGCTGCAGATGCCATCTGCAAACTCGA
TGACGGCGAATCTTGGATACTTCTGGCAGAGTGATGACAGCATGGGCTACAGCCTAAACGTGATCACAAATGCGGTCGGAGGCGGTACGATGGTGAGCGT
GGTGAAACCAATTGATGTAAAGAATGATCGCTTCTTTGAGTCTGGCACGAATTACTCGGTGCCAAGTGTTGGTAACTTGACGCTGGAGGGCGTAGGCACT
GACCTCAGTGTGCAGAGCTTCAACAATGTTGACAGTCTGTGTGCGATATCGGTGCGTATTTCGCCCCTCTCGTGGCGATCATACGTCTACTACGTGTTGT
TCCTGTTTGCTGGAGGTATTGTTGCGCCTGTGGTGGGGTTCCTAGCCAACTATTTCGTCACATACCTTGGATTGTGGCATCCGCACGTTCGACGAGATCA
TTGGTATCGATGTGTGCATCGTCTCCAGAAGCTCAAGCGGCAAGAAACGTCTACGCGATTCAATTCGTTTGCTCCACAGCACACTAGCTCATTGGATGAT
GACGATTCTGCAGCAGTTATCGCCAAGACAAAGGCGGCCAGTTTACCGTTACCAACACCAACGGCACCGCTATTAATCAAGTGGTGGATTCAGTGATCAA
GTTGGATACAGAGACTGCTGTGCGGATGGGAACTGGAAATCTGGCACCAGCCTCTGTTCGAATTGACAGCAGCACGCAATCTGAGGAGTCGTTCGAAGCT
CCGTCGCCGCCACCCAGCGCTGTCAGCTGGCATGTAGATGCAGAAGATACTTACGCAGCCATGTTTAAGGCAATCTCCAACGCCAAGTACGAGATACTAA
TTGCCGGTTGGTGGGTGTGTCCTGACCTGTTCTTGCTTCGTCCCGGTCGAAAATTGCCGCCACGTGAACCAAACGAAGATCCCAACGGGCAGCAAGTGAA
CAAGTCGCAACTTCGCCAGTTGCTGACGAAGAAAGCGGAGGCCGGTGTCAAGATCTACGTGCTTATTTATCGTGAAGTGAAGTTGGCTCTCACGCTGAAC
AGCGCATACACCAAGCGCAGTCTGATGCTTCACCCGAATATCCGCGTCCTCCGTGATCCAATTTCCAGATTCAAAGTCTTGGATTCTGGTCTCACCACGA
GAAGATTGTTTGCATCGACCAGTCGCTAGCGTTTGTCGGTGGTTTGGATCTGTGCTTTGGACGGTATGACCACCATGGGCAGCCAATCAGCGACCCGGAG
ATGATCCTATTTGGCGAGGCAAGATTACTAACCGATCATCAAGGACTTTGTACGAGTGAACAAACCGTTCGAAGACCTGATTGATCGATCTTCGCACCTC
GAATGCCATGGCACGACGTTCATTGCAGCATTTCTGGCCCACCTGTGCAGGACGTGGCATTCCATTTCATCCAACGATGGAATTTTGTGTGCTCCAAGAA
TGACTATCAACTACGAACAGGCTGGTGCATTTGCTTTCGCTCTCGAAGATTTAAATTCCTGCCGAAATGCCTTGTGCCGATGGATTTTAACGGATGGACG
CTGCAGTATCCGTCTTCAGACCCTGACGTGCGTGACGGCTCAACTCGTACAACCATTCCACTTGTACGCGAAGACTCTCTGAGTATGGAGCCCTTCCAAG
TGGTTCAGTCTGTAAACGCTATGTACCCCTGCGCCGCAACGGGTCCTCAGTGGCTACCAACGTCGTCGTTGCACCCTCTTAACCCCTTGCGCCCGATTGC
GAATGAATCGGCGACTACCGGGCCCTTAGACGATGGCGAAGTGCTGCGTGCTCAGCGTGGCGAGTCTATTCTGCAGGTGTTCCACCCGAACGCCAATATC
TGCAACATTCAGGTGTGCCGCTCAGTATCTATGTGGTCGGCAGGCGTGCCTACAGAAGCCAGCATTCAAGTCGCTTACATGGATGTGATTGCGAACTCGA
AGCACTTCTTGTACATCGAGAACCAGTTCTTCATTTCTGGAATGGACGGGAATGGCATCGTGCGAAACCGGATTCTGCAAGCGTTGGTGGATCGGATCGA
GCGTGCTGTGCAGCGTGATGAAAAATTCCGAGTTTACGTCGTGATGCCGCTGCTGCCTGCATTCGAAGGCAACGTCCGCAGCCACGAGCTCACAAATCTC
CATGCAGTCATGCACTGGCAGTTTGCTACAATTTGCCGTGGGCGGTACAGTCTTTTCGAGGCGCTGAAGGGCGTAACAAATCACCCCGAGGAGTATGTGG
CGTTCTTTGGACTACGCAAGTACGGTATTATGCCGAACGGATGTGTGTCCACCGAACAAATCTACATCCACAGCAAACTTATGATAGCTGATGACCGATG
CGCTATCATCGGCAGTGCGAACATCAACGACCGCAGTATGAATGGTGACCGTGATTCGGAAATCGCCCTGGTGATCGAGGATATGCAGTATGAGGACGGT
GTGATGAACGAGAAGCCGTACCGACGCGGTCTGTCAGCCAGCAAGCTCCGCATGCAACTTTTCCGCGAGCATTTGGGACTTGGCGACGATGATCTCTCCA
TCGTAGATGCGACGTCGGATCACACGTGGAAGACCATCAAGTCTGCTGCTTCAACCAATACGAAGATTTTCGAGAGCGTGTTTGACTGTGCGCCTTCGAA
CCGCATGCGCGCGTTTGTGAACTTTCAGAGCATTGAGGTGACGCAGATTTTCGAGAACCAGCGTATGAATGTGCTGAAGGTACCGGGTCGATCTCATGTA
TGGGATGCTGCCAATCTGAAGGATGGCGACTATGCGCCATGGACCGATGTGAATGGTGTGCCCATCGCGGCAGACCGTGTGGACCTGAGAGACTTCGAAG
TTGATAACTACAAGGACAGCAAGGACAGAAAGAAGAAGCTGTTCTCCATGGATCACGATGGCTGGTGCTACGCGCGAAACTTCTCTATCTTCCAGGAGGT
TCGCACCATGAAAACGGACTATAGAAAACGCGAAAAGTTACAGCATCTCGTAGCCGACAGGTTGATGGCCCAGGTACGACGTCGGCGATGGGTGAAAAAG
GGTTTTATGCCCCCACGACCTGATCCCCGCGAAAGCTCCTTCAGCATGGCCAGTGACGACGAGGAACACGGACGATTTTACTCGATCTGGCGAAGGCTTC
AGCAAGGTGATTTCAGTCGCTCGAACTCCATCAGCATGACTCCGACCAATTTCAGTCAGATGGACACTGGTAGTGGAATCGCTGGCAGTGTGAGCGTCGG
AGGCACCAACCAGCGTCGTCTGCACAATTCGGTATCGATGCCATCCGGTAGTTCGTTCTTGGTTGGGGACAGTACGCCGCTGCAGCCTGTGGTGCTCGGA
GATACGCCATCTTATCCAAACTCGCCCAGTGTTTCGAGCTTCCAGCAAACGCCTCAGAGTCCATCAGTGAATGCACTCGTTGGCGGTCCACGGAGTGTTC
GCAGTGCGCGCACGTCGTCCCTCCTTGGAACTGGTGGTGGTGTCCGTACACGTGACAACACCCGCAGTGCTCGAGGTAGTTTCTACGGTATGTTCAGTGT
TACTGGAGGCAATCGCCAGCTCGATACCGATGACGATTCCAGCGATGCAGGAAGTGACTACGGAGGAGGCCACGGCATCCGCGCGTCGCTCAAGCGGTGG
TACTCCACGATGGATGTGCTGGACTTCGGGCGTCGCTCCAAGTTCAACGCGGAGTACTTCGACGCGGACGAGGACCATATCAATGGAGAGGATCCGCTCC
TTGAGGATGGCCGAGGCAGCTACCACGCTGCTACTCGCGAAGGTCTCCTAACCGAGGAAGTCGCGGATGAATCTGGTGGAGAAGACGCTGATTGCCAGAT
CAGCCACGTGCAGACTGCAGCTACGGTTCGCAAGGAGGACGAAACGCGCGCTCGTGGCCAGCTCTCGGAGATCCGCGGCCACCTCGTCGAGTTCCCGCTG
GACTTCCTGGTCGAAGAGATCCTCAAGCCGTCTGTGCTGCCTGCCGACATTCATATTTAAGCAAGCGACGCTGCGTCAAGAGTAGCGATAGACACACAAC
AACAAGGAGGTCGCACGGCCAAGCGTACAGATAGATAGTTTCGGCCCGATTTTATTTGCGTTTATGCAATTTAGTTTGAATTTGAAGTTTTCGTCATGTT
CGTGTTCGAGGCAATTGACAGCGGTGACCTGGCGCTTCTGGACGTGGCCACAAAGGCCCAGCTGCCGTTCGACGAGTATGTGGTGGTTGCTGGACGTGTG
CAGAGCTCGCGGCAGCTCACGTGTCTCGGCGGACGTGTCAAGCGTGACGGAAAGCGGCGGCTACTGGTCGTCCCGTTAGCTCAAGCGGAGGCTGCCGGAA
ATCCGAGCGTGCAGGTGCTGGACGTGGGCGAAGTGGCCGTCAACTTGTTGCAAGGAGTGCGCGCGTGCTTCCCGACGCTGGTGAAGAAGAATCCGTTGGC
AGGTCTACCCATGGACGACAGCAGCGACTCGGACGAGGAAGATGGAGATGCGCGCAAGAAGCAGAAGCACGACGAAGATGCAAACCGCCCTGTTGACTCC
GAGGCTGCAAAGACTCAACAGCTGATGGCGGACGCTGTTGAATACATGAGCCAGACACGCGTGAAGGTGCTCGCGACGCTGGACGAGCTGTTTAGTGCCT
TCCAGATTGCAGACCCGACGAATGTGCTGATGTCGCTGCGCAACGATCCGTCGCTGCCCAAGCACTGCCAGTTGCTGTGTATGGACTGTCCTCCTCTCGG
TACTGTGGAGAATGGAGCGCATGGCGCTGTGTCGCATGCTTTCTCTTCATCTTCAGGTCCGCCAGAGCCCTTCAACTTTGGCGTCTTGTTCTCGGAAGTG
GCGACGAGCAAGGGGGAAGAACAGTTTCTGCATATTCCAGTGCCGCGCTCACCGCCTCTACCAGCGCCAGGAGCTCAAGGAGAAGACTACATGCAGGAGA
GTTTCCAGGATGCCACGGTGCTGACGTTCGGCGCCAAACGCGAGGCAACTGCGCATGGCGGGGGCAAGACCTGCGAAGAACTGGTGAAGAACATCCGCAT
GCGTCACGCATCGGGCACATTCTGCACGCTCGTACTTCCCACGAAGACATGGGAGGAAGTTGTTGAAGAGCACAAGGCGTTCCTTCCCCAGGTGTGTGAG
CTATATGGCGAGTTGCGGCAGCGTCGTCTCATGGGCAATGCTCCCTGCGGTGTCCCCATCGAGCTGCTACTTGAAAACTGAACGAAATACGCCACATCCA
TTGCAACAACATGCTGAATGAAGAGATACACAGGTAGGTCGTCTCGAACCCCACTTTTTGAATGGAAAATGTAGTTGCTCGTCTGCATGCCTTACTGTGG
CCTGCCACTGAGGCACATCCAGTAGTCGTTCTCCTTCAAAATGGATCCGTCCTCGTTGTTCGTGGCGCGTGGTGTCCTCGCTCCACGCGGGTTCTTCTCC
GGCCGCCAGAGCCACTTGGACGGGATGAGTCCGTCAAGCACGTCTTCGTCGTCGCCCGCTTCGTGCTCGTTGTACGACGTGACCAGCAGAGGTACTTGCA
CCTCTCCCAGCACGAGTCTGATAGCCGGTAGCCACTCGTCGTAGCCCCAGATACCAGCATTGAAGCACACCACGAGGTCCGGCGCGCAGTACAGCGTCTT
GTCCTCGAAGTAGGCCTCAAAGCCGCCCACGAAGTAGCTCACGTCCACGTGTCCCGTCTCGGCTTCATCAAAGCTGAAGCTTTGCAGGTGCAGCTTCCTG
GATAAATTAGGCCCCACGAGCACCAGTTTGAGCGTAGACAGGTGGGTCTCCGTGGCCACGTACTGCGAAAAGCTCCGGAAGACGTCGAAAGTCTCAGCTC
CCGAGTTGCCCTCGCGGTGATCGGCGCCCAGCAGATGCACAGTCAGCGACTTGCTAAAAGTGACATCACCACTGTGCGCGTGTTGCAGACGCTTGATCCA
CTCCACGAGCGTCGCGGCGCGGGTCTCACAGGCGGATGCGAATGCCATCGCTGTCGTTATTGGCACAACCTAGTATTGGTGGTCGCGGTAGCGTTTTGTA
GGAAGAGCTATCTAGATTAACCTATAGAATTGAATGCCTGCGGTATAAAACTTCAGAAACGACGAACGATCGTATTCGTTGCACGTGGCGGCGATGCTGG
CACCCGATACGACGTGGATGGACACGGGCAGCTACCCACACCGCTATCTCTATGTGGCGTTCGCCATCTTCCAGTGCTTTCTGGGCGCTGGGGTCATCTT
CGGCTGGTACCGGGGGGGCGACATTTTGGTTCTTTTACATCTTGGTGTGACGTTTGCATTGCTGCGTGATAGGACGTCGCTGGTGCCGTTGCTGGAGAAG
GAGCGGAATCTACAATGAATTCTGCAAAACTGGAGAAACCAGTACGTGGAGCAGGCAGAGTCGGAGGTGCTGATGTCGAGCTGACGGAGGAATTTCTGTT
GTTTGACTGCAGTCTGTACGGAACAGAGCGACCGTCTCCAGTATGCCTTCACGATGGCAGTCTCCAGCAGTATGTGGTCCAATCTGCTACTCGGCCTCGT
ATTTGACAAGTGAGTACTGCACATTGCTGCGACTTGAATTGTTAGAATTATGAAGGCGATGCTCTTGATTGACTCGAGAATGCGATGCGCTTGTAGATTC
GGACCCCGCGTGACGAAGTCGCTTTCGCTGGTGTTGTTGATTAGTGGCGCTTTGCTCATGGGCAATGCTCACTACAGGTGCTTTTGCTCGTTGGTTGGGA
TCTCTCCACGACTGCACTTTTGACAATGTTTACTTGTTGGTTTTCTTATCAGAGTGAACGCTGGAGGACACGATTTGTTGCTTTACGGAATGGTGCTTGT
CGGGTTCTCGGGTCCGGGCATCCAGCTCTCTGGTATTCATATGTCCAACTTGTTCCCCGAGGCAACGGCGCTGGTTGCGTGCTTCATCGTCGGAGGTCTT
CAGCTGAGCTTCTTGATTTTCACGCTGTTCGACCTCGCATACGAGCACCTCGGGTTGTCCATGTCCACGGTCTTTACGATGTACGCTTGCGTCCTGTTCC
TCTCGCTCATCGGCACACTACTGACGGAGCCGGACACGCCGTTCGAGGTCGTTCCCAGTGAAGAGCACGAGCTCCTCTCGCCCATGCGTCTGCCTTCCGT
GTTCAAGGAGGAGGAAGCCTCGCTGCTGATGTCTACACCTGAGTTAGAGAAGTACCGGAGACGCCATCGTCGACCAACTGACGAGGTTTTCTTCGATGGG
GATCTTCACAATCGCTCATTCAGGACGCAGGTGCTGTCCAAGCCGTTCCTGCTTATCGCGTTCTACTTCTCTATCCTCTCGCTTTGGTGCAACTTCTTCA
TTGGCAGCATTACAGGCCTGCTTCGGTGGAAAGGTCTCCCTGAGAGCGTGGTGGCCAACTTGCTTGGAAAGCTGGCGTTCGTGCTGCCGGGCAGCGTGAT
GTTCATCCCTTTCGTGGGATACCTACTGGAGAAGTGCGGGTACACGTACTCGTCGTTGGTGTGCACGGCGGTGGCGCTGTGCTTCACGGTCATGTTAAGC
AGCATGTCCACCGGGTGGATCGTGGCTGGCTTCGTGGCGTACGCGTTCTTCCGGACCATCATGTTCCCGCTGCTGTTCGCGTACCTGGGCCACCGCTTCG
GCTTCCAGCACTACGGGGCGCTGTCGGGCATTGCGTTCTGCATCGGCGGCGTCGTGGGGCTGTTGCAGACGCCCATTGCTGCCATCGGCGACTTCCAGAC
CATCGGTTATGTGCAGGTGAGTGCGTGGTTTGCTTCTGATTCTGGTCCGAGGGATCGGCATTGGTGGATCCATCTTCTGACTGTTGTGCTGTGGGTGTTC
GTTCGTCTACTGCTTGCATCGGACCCCGTTATAATAGTTGGGACACTGCTGCTGACCTTCGTGGCGCCCTACTTTGAGCGTCAGCGTGACGGGTACTACT
AGCGCAATGGGGCGTGTGTTCTGTGCCTCTCCAAGCGCGACAGGCGCAATGCGAAACAGACCGGAAAACCAACGCACTCGCCGACATCGGTCGATGCAAG
TCCATTGCCCGCTGACTCGAATGCGCCATGACTTCCTCGCGCGTGTTGCTGTCGAGTTGCCGTGCTTGGTGGCCGATCATGTCGCGCGCACAACCAAGCG
AAAGTAATTGAGCTCAACCTTCCGTGTTGTGGCTTTCGGACCAGGAATTAGTATTATACAGATGGTGCCGAGTGTGAAGACTTCGTTTCTGCTGTTGTTT
GTAGAGAATATTGCTGCTATTCTTGTGATTTTCGGACAGCCGTTTTTGGAGGTACCTACCCCGAGGAGCTGATCTTCCCCAGATGGCTGCACAGCTGAAA
CCATCGCAAGAAAACACGCAGCCTTCCCACCCTATAATATTAAGTTTACATATGAATCGATTCACTTATGTTCCCGTCACCCCCAATTTGTGTCCTAGTC
TACATACATAAATTTAATTATCTATTCATATCGTTATGTGAGGGTTGTGAAACAGCTGTATCATTCTTCGCAGACTTCAAATGTACCATTCCCTGGGTAC
AACTCAGTTTGCGGGGCGCCTTCCCCACTCATTAGCCATTTCGCCGAGCTGTGACGACTCCTCTCTCGCTCAATGTCGCTCTTCTCGCTCCCCAGCGTCC
TACGCCGCAGCGTGCCGTCCGACGGCAGCGACAGCGCGCCGGCCGTGCGTCCATCCGTCATCAGCACCAGCCACCTGAATGCGCAGCTCCTCGAGGAGGC
CAAGCACGCGGACCAGCACTTGTTCTTCGGGCCGCAGCAATCGGTGTTCGACGGTGAGCGCCAGCGTGTGATCCACGGCGAGCGCAAGATCCAGAAGAAC
ACCAAGCGGTTCTGGCTCATGTCCGAGCCGCTCAGCATGGACCGTGACAGTACCACGTCGCTCATTGGCTTCCCCACGGAGCAGACGCGCGCCGGTGGAA
TCGGCAGCAAAGTGACGGCGGCCACGCGCTTCCTGGGTCAGAAGGTGGCGCAGATGAAGTTCCCGGCCTCGCACGTGAACGAGGACTCGTTCTGCGACGG
CTGTGGCATGGACCCCATCGTGGGCAACATGTACTCGTGCTCCAAGTGTGTCAACTACCACCTGTGCGAAGGCTGCTACCAGCTGGGTATTCACGGCTTT
GAAGAGTCCAAGTTGCTGCTCGACGTGCGCGAGGACTTTGCCCTGCGTAAGGTCATGGACGTATGCAAGAACAAGGTGCCCGAGGAAGTCTTCACGGTGC
TGCTTAAGACGGTGTGTCGCGGACAGGTGGACAAGTTCAACTTCCTGGCCAAGTGGATCACGGCCGTCGTGCTCGGCCAGCCCGTCAACTCGCTCGAGGT
GCGCGGCATCGAGATTCCGCACCTCGACTCGGAGACGCGCGCGACGCTCGTGCAGCTGCTCACCCCCGTGCTCGCGGACCGCACGGACCTCGAGGTGTGC
ATGGAATGGTTCTGTCCGGTAGGTTTTCTTGTTCTTGAAGCGTTCGGCGAAGATGGGACTGATTTTTTATTGCTGGCTTCTTGATGATGAATTAGGACGC
TGATAAGATGGACCTGCCCGGTGTACAGCGCCGCATGGAGACCATCCGGATCTGGGTGGCCACCGACAAGGACCAGAAGTCCCTTCGCTACCAAGGATGG
CCTCAAGGACGAAGACACCGAGTCGGACATGTCCCCGACTAGTGGCAATGGAGATGTTATGGACTCGCCTGGCCCCGCCAGCCCCGTTTCGAGCGTCAAA
GAACCGGAGTCGCCGGGCGCTACGCCGCCTCCGTCGCCCAGCGCAATCCGCCGCAAATCCACGGGAGCGACATCCATGACGTCCGAGTCATCGTCGCAGG
CCTCTCCTCCGCGTCTCGGTGCACTTTCACTGGCTGACAAGACTGCCGAATACAGTTACGAGGACGAGGACGAGGACTACATGTCCGACTCGGTTAAGAG
CGACATTGAGCCCCGGAAAGTGGACAGTTTGTCGCCCTCCTCCGGTCACCGATCGGAAGGCATTGAGATGTAAAAAGAGCGAGGGAGGAGCGAGGAGCGG
ACAAGATGCGACTGTGAATGGGCTGCTACTCAGTGCAAGCCGTAGACACAGCGGGTCAAGTGCGCGTTCTTGGTCTTCCTTCATTTTGTTATTTTCATTT
TCGCTTTGCTTTCACCAAATGTAAGAAGGGGTTGCTAGGATATATAAAAATCATCTTCATCCACTGCGTTCACGTTCAATGAAGCTGGTATAAGAAACAA
CAGATTCGAGAAGTGTCGATTAACCTTTTCTTCTCTTCTTCGTGAAGACGGCAAGTACAGTACCCGTATCTCGTGTCTACTCGGCTACGTGCTCGCACGA
AACCATTTGCACAACGGATATTTCACTCGTCGGCAATTTGTCGTGCGCTCTTTTATCATACCCACGCGCTCGCATCCTAGTTCTTGGCACGGTAGAAGGT
AAGGTAAGCCATGTGCCAGTCACCCCCGCCCTTGAGCTTCATGATGTCCTCTGTCTTGCACGGCGACACATCGTCATCATCGTAGCAATACCAGTCGTCT
ATCATTGCACAAAACACGTTATCAGCTTCTTCGTCACCTGACGCGTATGATGAATAAACCACCGTGTGCTCACCTCCTTCATGGCGCACCCAAGCCATAT
AGTGACCAGAATCGGCCGAACGACCCTTGTGCGTCAGAATAGCGAACAGCTCGTAGTTTCCCTATGTCAAGCACAACACGAACGTAAGCATAAACCATCC
AACCACATACACAAAGCACACTAGGCATCAAATACGTACTTGGAAGTCAATAGGAAGGTCAATACCAGGAGACTTGGCTCCCATCGAAAGCGCGCGAGCA
GTCTCGAGAGCCGCTCTGTCCTCCTCGGACAGCCCGTCCATAGCGTCATCCTCATCAGCCTCTTCCTTCGTCTCTTCGACGTCCTCCTTCTTCTCACCTG
CAGGTTTCTGCTAAGTGAAAGCGGTACATCAAGCAAGAACGTAATGAGCGTGAGTTCTCCTTTCTCAATTACACCGCACTGTGATACCGCGTACGTACGT
CCTTGAACTCGTTCAAAATCTTTCGGCATTCCTGTCACGGGAGATCTTCATGGTTGCCTGTAGCTCGTCAGAGCAGAAGTCGAAGACATCCAGTGTCGTG
GGGAAACTGATAGGCTGCAGAACCAAACGTGTTCCGTCAATGGACGTGCCTAACAAGCGCAAGGAAATACTTTCTTTACCCGCAGCATTTTGCACTTGAC
ACCGGTGTGGTCGCGGCTCTCCGGCGTCGCCTTCCAGTAGAAGCGCATAAACTGTACGCACAGTACTTGGGCAGGCGTTTATCCGAAGCGTTTTCTTCCA
CACCGCGTTGCGATCCAGCACATCCGAGTGCTTCTCAATCGTTCCTTCCAGTCCCTATTCACCAATCACATCTTCAATAAGACACCCAATCTCCATCCCA
ACCCAAATCAAAGCAACAATCATAAAACTTACAATCTTGATGCCTTCGGACAGGTGGTTGGTCTCAATGGTGATGTTGCACACGAGCTTGAGCGCCTTCT
CCTTCTTCAAGACGGGGGTCTCCATCTCGCTCTCCGTGCACTCAATTTTCTCATTCAACTCCAACCCAAACAACGCGTCCACGACGTTGCTCGTGGGTCC
GAGAGTCTTTAGTGCCCCCGCGGGTTGCGTCAGCGTCTGCTGCAGCGTCGCAAAGAGCGTGGACAGGAACTCCTCGCTGTCCTGCTGCATGTACCCGCCA
CTCCTGGGCGACTGCTGCGCGAACTGCGGGTACGCGCGACGCAGCACGGACACGAACATGGAGGGGGTGATGCTGTCCACGCTGCCATCCAGCTGTGTGT
ACATGTCCTTGAGTGCAGTAGTAAAGTTGTTGGCCAGGTCAGCAGACACGCCACCCGCCTGGGCCTTGAAAGCCTCGCGCAGCTCCTTCACGGGCCGCAA
ACACTGGAGCGTGGCGTTCATGTAGCACGTATTGCGAGGTTCACGAGGCCTGCGGGATACACTGTGCCAGTAGCTGCGATATCCTTGGTGGTCATGTCCT
CAATGAAGATAATGGGCTCCTTGGGCTGTTCACACCTCGGCCGTCCCATGAGCATGACACCTGTGCCGTCCACGAGCTTGTCGAGCGTCGAGAGGTCCAC
GTCGTCCTTGAGCATCCCCTTCCAGGCCTTGGACATGAGCTTCTGGCGCTCCACAGGCACGGACGTGAGCGCGTACAGCTGCGCCTTGAGCACGGCCACG
GGAGCTGACTTGTCCACCGCCACGTCCTTGAACACCTGCTTTCCCCATTTGACACTCACCTGGGCCGTCATGACTAGCGTTGATCCTTGGAGCTCTTGTT
GGACTGTGGGGGATTGAAGATCGCGACCTCGAGAAGCTTCATTTGATTGGCAGAAAACATATTATACGGCTGATGATTGGTGGAATGTGATTACGAAATC
AATGTCGAATTTTGGAAATTGGATTCGTAGAGATTCGCACATGGCTACATGCATGCACTGCTTATAGATCTTAGGATACTTTCTTCTTCGCTTAACGTTT
TGGCACCTCTCATCCCGCTCGGTACTTGGATGTCGTCAAGGCGACCGTATCACGCAGAATGGCGTCGCCCGTCGCCTGGTCTTCGAACCACTGCATGCTC
GCGTGAGTGCGGTTGGCCACATTCAGTAGCGAGAAGCCGTAGTCAGCTTGCCGGAAGGCTGACCACTCCGGCTGCGGGTCGAAATACGTCGGTGCCAGGC
CTTCGCGGTTGCCGGCATCGCCTAGCACAACGTACACGGGGGCGTCTTCAACGACCTTCTGCTTGTACACTGGGTGACTGCGCTCGTAAGCGTGGACGTG
TCCGGAGACGACGACATCCACCTTGTTCCGGTAGAGAATATCCTCCATGTTCTTCTTCATGATCATGTGTGGCTCCATGCCCTGGTGCGCCGTGTTGCTG
TTGTACCACGGCCCGTGCATGATTACCACCAACCACGGGGTGACGCTGCGGTCGACGCGCTGGAACTCTTGCTGCACCCACTCGTACTGCAGCGAATCGG
GAGTCGAGTCGACGTACGGCGTCAAGATGACGAAGTGCACCAGGCCCACGCGGAAGCCGTAGTACAGGTTGCGACGCTGCAGCTGGTCCGTCCGCTCGTA
CGGCATACGGAATCGCGTCTGGTACGCGACGAACTCGCTCACTTCGCGCTGACAAGGCCGCTCCATCTCGTGATTGCCCGCTGAGATCATCCACGGCATC
CGGGCAATCAGCGGCTCGACGAGCTTGCCCCACCGATCCCAGCGGTACTGCTCACTGTCGGCGTACGACAGATCGCCAGCACACACGATCATACTCATCT
TCGACTGGAGGCCAGCGAGGTGGCGAATTGTCTCCTCCGAGTACTCAGTTTGACTAGAGTAAAGAAACAGCTCGATTAGAATCAAGAGCGTTATCCTCAG
CATGCATTGTAACACAGTAGCTTACCCGAGGTCACCAATCACGCCGAACGTCTGCGGGGCCTCACTGCCGACAGGTACAGCCGTCTTGAATGAGTACACA
GGACTCCACCCACCCGTTTCATCACCGCACTGGTCTGTACAACACACACACAGTCAGCCTTTCAGTCTGACACAACGTACACCACTACTACATACAGTAG
TAAGTCGTGTCCGCAACCAACTTGTCGCCGGGGATCGTCACATGGTGTAGCCACGGCGACGTGTACGTGCAGAAGTCGTACTGCTCGCACGGTTCCTCGG
CCTGCTGCACGGTCGAAAGGGCGTCCTTGTCTAGTCCGTAGCGCACCGTGGACTTAGTCGTCTTGACTTCCGTCGCCCAGGAGACGGTCATGCCCAGCCT
CAGCTCCGAGGCTGCAGCGTTTGCATTGCGGATGGCTGCGTAGCTCTTCACGGCCATTTCACCGGCCAAGGCGACGTGGATCTGAGCCGGCGGTGCAGCG
TTTGAGGGCACCGCGAGCATTGAAGTGGCGTGGCTCAGACTCTCGTCGTACACCGGCACGCGGAACATGTTGACTAGCACAAAGGCTGAGGTGAAGAGCA
GCACAGAGATGCCGAGGATCGCCATCCTGGAGTGTGTCGAAGATGGTTTTATTTCGAGAAGAGGCGCGCTCGAGTTCTTCCGCCCGGCGTTGGTGGTGCG
AGTGTTCGCAGAATTGACTCGTGGGCGAATCGTCGATCCGTACGAGACTACAGCCACAGGTCGGGGACAACAGCCAGAGTGGCTTCATCTTTGTGTCAAT
ACGAATGGAAAATGAGGGATGCCTTGCCCATGAGAGCCGAGGTGCAGGCAGATTCAGAGCGCTGGTATCCTGGCAATGGAGAGAATCTTCGTCCTCCGTG
AGAACCGGCCGCGATGCTGTTGTATTTGCAGAGCACCAGATGGGATCGTCCTCCAAAGTGAATCGGGCTTACCAAAAATCTCTTGTGACGTGTTCGAACG
CAACATAAGATTGGACCAAG