Description :
From Genome Similarity Track
Location :
Scaffold_173:60712- 62637
Transcript NameFunction/comments
Hyaar_Emoy2811861Drug/Metabolite Transporter (DMT) Superfamily

Sequence
1925 bases(100 bases per row)
GCGGTACTGTCGTTCGTGCCATAGGTGTTCTTTCCAGCGGCATTGCGACCCAAAAGTCGGATTTCGCTGCCACTTCCTGTGCGCCGAATCATTGGGCTCT
GACGGTACACCACTTTTCCACGGCGCTTCCGCATGAGATGCGTCTTTTGCAACGACGGCGACGCATACATGGGGGACTTTTCCACCGACTGTGAGCCGCG
CTTACGCTCTTCTTTCTCGGAATGGTAAACCAGCAGTCCCATCACAAGTACGACAAGCGAAAATCCATCGTAGATAGTGAATGACTGGCCAGCAAATTTG
CCCGTGAGAAACGGAATCATGTACAGCAAGTCGGTGAGGGGAAGTCCTACAGCGGACGAAACCACGAAAAGCACACTACTGCCTTCCTTGAAGATATACA
GCATGAGCTGATTGTAGACTGTGTTGAAAATGATAAAGACCAAAAAGACCTCCATCACACCTGCGTCACACGCTAGCACCTTGCCGTTCAGCTCAACCTC
GTTGCCAATGAAACACTCGTGGGCCTTCGCCACATAGGATGGGAAGTCTATCCAAGGTACTGGCGGATCGCTGAATGCCTTGATTCGCACTGTCCAAATT
GTAGCAGCACCGATGATAAGCTGATAAAAGCTGATCCAGATGTTGGCATACCATATGTCCAAGTCCACGTCTTTCAGTCCAATTTCCTTATAGACATTTG
AAGCCGCCGCTGGCACCAGTGATACGATGTACAAAGTAATCCACCCCGCACTTGGGTCCGGTGTGTTGACGTTGTCCTGGCCCGTAAGAGTAGGAATCAA
GTTCACCATTCCACCGTACAGCACCAGGATGGAGCCCAGAATATGGCCGCGCTTGAAGCGCGTCTGCAAGAACATGTACGATAGTAGCATATTGAACGGC
AGATTCAACTGGTTCAGCACGTTGGCCATGTTCCCCCTGATTGCATCGAATCCGACCGCGTCAATGACGTTAAACAAAACACAAGAACACTAAGAAGACT
CTCCATGAAAAACACAGCACTCAGAAGCAACAGGTACCCAATATGAGGTGTGGGGAACGCGCCAAGCAGGTTATACAGCGTGTCAAACAGCGCCATCAGC
ATGTACTTGTAGTGCGGAAAATCACGCATCTCTTGCGTAATGTCGTCTACGACAACATACGCATATCATTGATAAATGTTCCGTCAATGAGCAAGAAGGA
CAACCCCAGCCAATATATCGCAATAGGACAAGATCGTACCGGTAAAATAGAGTTTGTACCTGGTTAAAAAGCACATTGCAGCGTTAGTAACGTTACTTGA
CTCCGTGTCAAGATCGTGTGGATAGAAAGTAACGTACGCTACTACAGGAGCTGATGAGATCAAGAAGGAGATGGGAAGGATCACGTTTGTGAAGTACCAG
AGGAAGTCCGTATAGTCGTACGTGATCCGTCTAGAGTATACAAAAACAGAGCACAGCGAAGGGTGAAGGAGCCATTAGCGAATCACGCGACACCGTTGTA
CGTACGTGTAGAGCACGCGGTCCACGCATCGCGCCATGATGAGCAGACAGAGCGCGACCGCTAGCTTGGACTCCCACAGGAGTCGCTTTACGTTCATCGT
TTCGTTGCGTGGCTCTCTAGGATCGCCACCGACCTTTTATGTGGCTGTTTGAATGTGGTTGTGGTATCTGCTAGTGTCTGGTTCAAGCAAAAAGATCGAT
TGCGATCCGGTTAATTTTAGACGTCGATCAAATACATTTGACCAATCAACAAGCGAATTGAAAACATGTCAAAATCTCATTATCTTGGTTTTGACATAAA
AGCAGGATAGACTGCAGCGATGGAGGATCACGGCTTAATGCGCATGCAGGAGCTGATGAGCAGCTACTATGGACTTAATGATCACGAGAGCAGAAAAGTT
CAAGATCGGAGCATGGACTCGACTG