Description :
From Genome Similarity Track
Location :
Scaffold_1:607110- 609163
Sequence
2053 bases(100 bases per row)
GCAATTATCCAAAAAGTAGACCAAACTGGAAGCTCTCAGTCGTCACGAGTCCAGAACAGCCACGTCTGCAACAAAATGTGTCATCATGTTTTTCATCGTT
TTATCGTTTCATTTAATTTTCTTGTATCGCACAAGCCGCGACTACATATCTTTCTTATCGATAGAATCCTTTCGTTTTCTCGGACTATCTAAACATCCTC
CTTTAATAGACTACATCTCCTTTCTTGTAAAATCCAGTACACAATTGTAGATAAATAGTGCTTTTAAACGGGCTCCGCGATTTTTAATGCAGACGACAGA
CTGTAGGTGTGTAAAGTCGGCGTGGCACACGAGCAAAAAACTAAAATACGTTTTCAAATGATAGGCTAGAGCTCGCTTTGCCCAAGCTTAAAAACTTAGC
GTTAGTATTAGAAGCCATACATCTTGGTGGGCACAAGCTAAGTTAATCTAAACACTATAAATAGGGAATCACTCGATCGCCGCTATCTTCTTGTTCTGTC
ACCTGCAGTTTTACCCAAATACTACAATTGCCCACAATCGTACCCAATTGCATATCTAATGTTTGCTACTCCCATCGTTTTTATTCATTTCTCCTATTTT
TTGTACGCTCAAGCCGAGACTGCGTAGTCTTTTTCTTTCGTTTTTACATTTTATTTTCTTGTTGCTTGCTGTATTCTTGCCCAACTCAGCTATAGTGAGG
CGCGTGGAGGAGCAGGTTAGTGCGTTGTGTTCAGAACAAAGACACATGCGACAACGCCGAGCAACGAAAATTGGCTCAACCGATATCTCCACATGCTAAC
TCTATAAGTTATCGCTGCGTCAACCTAAATGATAGTTGGTTCGTCTTTCCTGAAGTTCTCCCGCTTACTTGGATTCTTTCTGGTTCATTTAACACTATCA
TATTCCAATAATTTAAGCTCAATAGATCGTTTATAACGCATCTGTCTCTTTTCGGTATATTCGATTGCCCTAGTTGCTGAACGCGTTACCCAACAGTATT
TTCTGCCAAGTCGCTGGTAGCAAACGATCCACTTCCGTCATCGACGCTATTCGGGGGTCATGAAGAAGACAGGGCTACGTATCAATTACGTGGATAAGCC
TGTCTTCGCGCATTTTATCTTTTTCTGTAGAATTGAGGAGTTATTAACGGAGCAAAAAATGTTCCACCCGATACATGAATAGAGACTTCTGCTCACTGTA
GTAATAAGCGACGTCTGGTCGAGAGCATGGACGAAGTGGTGTGTTTCTTTTCCTCTTGACCCTCAGCCTTGTAGCTGACCGTTTTCGTAGCTACCTTCTC
ACGAAGTGCAACATATTGGCCATGTTGGCAACCTTGCGCTTTGCATTGCTTGGTGGCTATACTCGTGTATGTGCTTTTTTTGTTATAAGCTCGCGCTTGA
GTAGCTCCATAAGTCTCTGTGCTCACGCAACGTTTACGGCTTCTTCGTTGGGAGTTCCACTTTTTATCTCAATCAAGAAACGATAGAACAAAAGGATAAA
ACGATTAATAAATATGAAAACTGATTTCGGCAAATTCATATATGTTTTGGGGAGCAACAAACGAGTGATTTCCAATTGGGTACCATTTTGGGTAATTGTG
GTAAATTTAGGTAAAACTGCAGGCGACAGAACAAGAAGGTAGCGACGTTCGAGGACTCCCATAGTTTATTATATTTATGATATTATTTAATAAAAAGTTA
AAATTATCGAGTTTTTATTCCACAAAGTAATTTAAGTTCCATATTTTGATGCAATTTCTTAGGAATTACCTGTAGAAATATAGGCGAAAATATAATTGAA
CAAACATATAGAATGGATGTGATACCGCATTAAATTTATACAGAATCAAATATGTATACTTATTGATACAAAACAAATATGAATGCAAAAAAGTTGTTAT
AAAAGTTGTAAATGTCGTAGTTTTTTTATCAAATGGAAGATCAAATGAAAAACACAATCATACGCGAAAAAAAAGCATCTACTCCAAGATGAAAAATGAT
AAGAATGCAGCCGCTATTGAACTCCCAGTTTTTTTCTATTGAGCATTTACCCG