Description :
From Genome Similarity Track
Location :
Scaffold_216:6070- 7282
Transcript NameFunction/comments
Phypl_g5415hypothetical protein

Sequence
1212 bases(100 bases per row)
TATTCCTTGGTGATAGGAatgcagctcctgcgccagctcgcggtGTGGTGTGGGATTTGGACGTCGGTGACGCTAGGCCTGTGGCTCCGCGTCCTCGATC
TATCGCCCCACACCTGATGATCAAGGTGTATgagttgctgaagaagcttcTGGAGACCGGACTGGTCGAACACTCCGAATCTCCGTGGGCTTCGCCAATT
GTGATTgtcctcaagaagaacggcaaggATATCAGGATGTACATCGATTATCGCGTTGTGAAGGGCTTCATTCAGCTTTCCAACTACCCACTTCCCCTAA
TTGATGACCTGCTGATCGGCTTCGAGCGAGCTATATGGTTCATGAGCCTAGACATGGCCAGTGGATTTTGGGCAGTCCGGATGACAAAGAGAGCCAAGAT
GATCTCGGCATTTGTCTGTCCATTCGGACACTTCCACTGGGTTCAAATGCCATTTGGGATGAAGAACACGCCACTGATCTACCAGCACGTGATCAACAAC
TGTTGGTGGGGTTTCGTTTGATTGCCTCctgaggaagaagctcttgTGGACCAAAACGTTCTGGACTACCTGAAGTTGGATCCCTACGAGCCACGACATC
TGGGTGGTTCGGAGGAAGTACATTCGGGACAGCGTCTATCAGTGCTGACAGAGCAAATGACGGCCTTCAAGCGGAACATCCCAGCTCAACCTCAAATGGG
TCCTGTCCTAGGTCGTAGTTCCTACATCGATGATATCGCGTATGGAGCAGCGACCTGGGACCAGCTGTGTGATGACTTGGACGCGCTGCTTTTCAGGCTG
TGTTACTGGGATATCTCGGTGAGCTTGCCCAAGAATGAGTTCGGGAAGCGAATTATCCCATATCTATCCCATGAAATAGGTGCCGAAGGAATTCGAGCTA
CTCCGAAGATCGCCAAAGGGATCCAGGAGCTACCGTTCCCATCCACCCTGAAGGGAGTCCAGTCGTTCTTGGGCAGCCTCAATTACTACCACAAGTTTAT
CGAGGATTTCCGTGTGGTTGCCGCAGTCCTGTATGAACTGACAGACGAACAAGTTCGGGTCGGTAGGGACCTAACTCGGGCGAATGAAGCCTAAAAAAGA
AGACTGTTTCCACTCCGATGCTTCGACACCCAGATCGAACCAAGCCGTTTGTGGTCATACCACATGCTAACCAGTGGGCAGCTTGCGCTGTTCTTGGGCA
GGAACATGATAG