Description :
From Genome Similarity Track
Location :
Scaffold_3005:607- 2955
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_3005-fgenesh-gene-0.0Insulin-degrading-like enzyme, metalloprotease family M16A

Sequence
2348 bases(100 bases per row)
GCACGCTAAGCTTCTTGCGCTCGGGCGCGTCGAGACTGATGTGGCGGTCAAAGAATTCGAGAATGTCCGAGGGTTGCAGCGTCGCGACGAGCTGCGCCAA
TGTCTCCTTGCGCTCGAAGACGTACTCGTGGTTGGAGATCTCCATGTGCATCAGCTGCACCTCCTCCTCTTGGCTCTTGGGCTTCTCCGAGTACTCCTTC
ACGACCGCCAGGATGTGTTTCTGGAACGCTTCGCTATCCATCGACGCAACCGTATCGCGGAAGTCATCCCAGAAGGCGTCAACACGTTGCTCGAGGTACT
CCGGCCCGGCTACGTTCGACTGCAGGATGATACGGAAGAACTGCACGCCGCTCGAGCGCGAGGGCGTCGAAAAGACAGTGTAGCCCAATTGCTCCTTGGT
GCGCAGCTGGTTGAAGAACGGCTCCTGCACAATCTGCGAAAACAGCGCGAGTGTGACGCGCTCGAGAGGAGTCTCCACACCAATCTGGTAGACCGAGTCG
AGCGCGCAGTTGGTGTTGTCCGGGTTCGGGTCCAGCTTCTGGTAGACGCACTGAACGCCAGCAGGCAGCTGGATCTGGCGCGCCATCCAATACCGCTGCG
TCTCCATCACAGGCAGCGAGAACGGTTGACGAATTGTGAGCTCGGCGACCATGTTTGTGATTTCCAAGGCCTGCTCCTGGTCCAGATTCCCGTAGAAGAA
CGCCTCCAGGAAGACTTGCTGGAAAGTGCGCGTGGCGTGATTCACGAGCATCGGGAACGTGCACTGACCGATTGCGGCGATGAGCTCGTCGTGGGTCCAC
GAGACGTCCTGCAGCAGGAATGTGGTCTCGTGCATCGCGTGGCGGTACGCTTCCTCTAGTCGAACGTTCTCGTAGGCGCGCATTGCTGCCTGCTTGACGC
GCGCAAACGTCTCTTCCTGGATGTCTTTGCTAAAACCAGTCATGAACTCGACGATGCGACGGATGAGCACGGGCAGCTTCGCGCTGTAGCCGACCGCGCC
CAGGTGAAGTGTGCTGCCACGTACCGCCAGATCGTAGTGCATACCAGCGAGCGACGCGTCGTACGAGTACTCGGTCAGCTCGTCCTGCACGCACATGACG
AAGAGATCCGAGAGCGCGTACGCGAGCGGCGAGCTGTTGACGTGCGGCGAGTGGAACGTCAGCGCTGCGTGGATCTTGGGCTTCTTGAAGTGCACGTCCG
CCTTGTGCCATACACGGCAGAAGTCGTCGTCTTTCAGAAGCACAGGGTACTTGGAGACACTCTCGCCAACAATGCTCGCGTCGATGAGAGCAAAGTCAGA
AGAGATGAACTCGTTGCGTTCTGGTAGAGAGAGCGCCGCGTTTTCTTCAGGAGTCGTCATGCACTGCAGGAAGTTTGCACTGAGAGCGGTGTCGCGGTAC
TTTGTGCCGTACCATTTCTCCTCCGACGTGGCTACTGCCTCGAGTGACTTGCAGACCACGAGTAGCTTCATATTCGCAGGGGTCATCACCTGAAGCAGCT
CCTGGATCTTCTCGCACTCGTACGGATAGTGCAGCGTGCCCTGTGTCAGGATGTCCTGCGTCGGGTGCGACTGCATGACGCCCGCGATGGCGCTCGTGAA
GTTGATCGGCGCGTGCTTGCTCTGGAAGAGGAAGTGCATGGTTGCGAGGTTCTCCAGTTCGTCGAACATCCACTTGTCCAGCACGCTTGTCGTGAGCAGC
TGCAGGTACTGGAACGTGGCCAGCAGCACGTCATCGAGGTGTGCAATGCCGGCCTCCGTCGCGTCAAAGTTGATGAGGAAGAGCGCAAACTCGTCGTGCT
CCTCGTCGATACCGGCGCTGAGCGAGTTGACCCACTTCTGCGTCTTGAGGAACGACAACAGCGAGCCCTTGCCCTCATGGCCGATGAGATGCGCTAGCAC
GGACGTGTGCTGCTGCGTGAAGCGCTTGCCGCGCACTGGTGGTAGCTGCCACGTCACGGCGATGATCTTGAGGTCCTTGACGGGCACCACGTCAAGGCGC
CGAGCGAGATGCTCGCTGTTGAACGGTAGCTCGCCCTCGAACGACGGCTTCTCGCGGCCCGTGTTGCGGATGTCGGCGAAGAGCTCCTCGACCCACTCGC
TGAGCGTCTCGACGCTCTCTTTGCCGTACACGACGAGCTTCATGATGTTGGCCGAGTAGTACCTCTCGTGGTACTCAAGCAACGCCTGGCGTACGTCGAC
GCCCTGCTCTTTTGGGGTCACGCTCAGCGTCTGCAGGTTGCCCACGCCGTAACGGTGATTCGGGTGCTTAACGTTGCCGAGTGCGCGGTGCGCCTGGTTG
ATGCGCCAGTAGTCGTCCTGCAGGTAATTGGTGTTCTCCGAGTCCACG