Description :
From Genome Similarity Track
Location :
Scaffold_1500:607- 2559
Sequence
1952 bases(100 bases per row)
TCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACGACTTAAAGGACAACACAAAGGCAAGGGAACACACCCGCAAGGCAACCCTACGGCCGGAT
CCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGGATACGGAACCATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCA
TCCCCACGTCTCGCCACGACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAG
GAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGATCTGGCAATCTCGCAGATTTGGCTG
ATCCCGCTACACCACAATGGTGCGCGTGTTCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGACGCTCAAGTGAAGATTAAGCCAGGG
GAAGAGGCGTCGTCGGAGGTCGGATCGACGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTGGGAGGAACTCTGTCGACGGAAGAGA
GGTGGATCCGGATCCGGATCTAGAAGAGAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGACTTGGGTCAAGATCCGCTAACA
AAACAAGGGAAAGTGAAGGCGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACTGTACCTAAACCCAGCCCCGCTAGTCGAAGAAACGAGAA
AGAAGACGAAAACGAGTAAGACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCT
CGAGTTTGTGTATCGCCACCAAGCTTTACGCGACTTCCTGCATCAAGATCCTGTCATGCAGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCG
GTGAGAGCACCAACGAAAATGGCGAACAAGTTGGTAACAGTCATGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAG
AGGATATCTTCGAGCTAGATCTGGATCTCATTGCATCCGCGACGCAGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGCGCTATGGA
TCCAGTGTCATCGCCGAGGATCAGCCAAGCTGCGTCCTCAAACTACGAATCCGCCGCTGAGGATGAGTCAGACACGTCGTCCGAGCCACGACGCATGACT
TTAGGACCCTCCGGGGCATCCATGCTGGAAGCGCGGGCGAGGGTCCGAAGACAGGAAGCCCCTGTGAACGTGAAGGCTCGGGATCCAGTAGGCCCTACGC
GTGATCTGACACAATCCATCCAGGATGGAGCCAGACCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCAGGCTCGAGGTAATCGCCTCACGGACCCTGT
CTCGCCAGTGGACCAGACGGCCACAGGCTCTTCCGATACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGGTTTCTGACCGAACAG
GGTATGAGAGCGCCCGTGCCACAAGTGCAAGTGCTCCACGAACATGGAGCACGAGACGTGGAGATGGAGTCCGTGGAGAGAGACAACTTCCATGATGAGT
TCGACCCAGATGATCTGGATGGCCCATCCACTTCGTCAGCAGTGGTAGCAACAGCCACAGCCGGGGCAGGTGGATCGTCTATGATCCAGAGGGTACGGAT
CTCAGCCATATCGGACCTGAAGGAGTTAACGGGCAAGGATCACGATGAGGACCGAGCGAGAACATGGATCAGCAAAGTCAAGTCGGCCCTCATGAGAGAT
CAAGCGTCGGATGCTGAGAAGTGTTTGACCTGTGCGGATCTCCTCGAGCCTG