Description :
From Genome Similarity Track
Location :
Scaffold_2069:607- 1997
Sequence
1390 bases(100 bases per row)
GCGCCCGTGTCCTCCAGATCGACCACCACGTCCACGGCCGCGACCTCGTCCTCGACCTCTTCCTCCACCAGCAAAGAACGCCTTTTTTCATCATGATTGT
CCTTGGCGCCCTCTGCTTTCCGACCTTGGCGATGGTCGTAAGCCATCTCCAATGCGAGTTCAAGTTGTTCACAATTAGGAGGATCATCAGCATTTTGGGG
CTTGTGACTGGCGAGAAACGTCTGTACAACATGATCATATTCGCGCGGCAGAGATCCAATCAATAGTGCTGGCTTTACATACTCGTCCACAGGACGCCCG
ACTCCAGCAATGGTCTCCATCAGCCGACGCATCTCGCTCAGGTGATCTGGTACATTGCCGTTGGGAGCGAGCCGTAACCGGCTGAGCTTGGCCCCCTCCT
CAGCGCACTTCAGGTACGTCTTGCCCATAATCTCTTTTTTAGGCGCTCCATGACACGAAACGGGGTGGGTTCATACTTCACAGTCTTCATTATGTGATTC
GTCATTGCGTCGTAGATGATCTCCTTGGCGTGGACCATCTCGCTCGTCCACGTCGCGTGCGCCTCTGCCTCCTTGCTCTCGTCCGGCTCGAGCCAGTCCT
CCATGCAGTACTTCCACAGCTTCTTCCTCTCCAGCTTGAGCTTGACTCGCTCGTGCCAGACCTCGTAGTCCTTGCCGTCAAACGGCGGGATCGTCCTCTT
CTCCTCGTGTGACTCCTTGGGCGTCTTCTTCTGCTCCGCCATGACGTCCTAGTTGCTGTGCTCCCCTCGCGTGAGCCTTGGGCTCATAACCTGAAGTGGA
GTGTCCTCTTGGTGCTGCTCACGCAGAGATGGAAGCAACGACAACACTCAGCTGGGCGGTAAAAGCCGTGTGTATATTCTCACCTGAGGCCTAGATTCTT
CTCTTTCACCTTTTGTCTTACTCCAACTGCAAGTAGTATAGTGGGGATCAGTATAATCCGCAACAATCTCGGGGATGCTTGCCAGCGCCATGGCAGCCAC
TGCGCTGAGGCTCGACAACTTTCGTAATGTAGTATTTTGCGTCTTCCGATGGCGAATGTGATCCAATCACGAGATCATAGAAAACGTACTATCTGACCAA
ATCCAAGACCTGTTCTGCATAAGTGTCATGATGCAGCATGTCTGCTGCTGGCACCCACGCAAGCGGGTACGCCAGCAACAGACATGCTCAAGGAATACGT
ACCTGGTGGCTAGGGAGTCAGGCGTCGCAGCGCCGCCGCCTCCTCCTCCGCCACAAGTAGCTTGCGCGCAGTGTCGCTTGAAGGCTGGCGCCAGGCTTGC
GCAAGACTGCCTGGCGCCCGGAATCCAGAACTCTACCTGCACAAGTATACAAACATGCATATATAGGATTACGAAAACGGAAAAAAATTG