Description :
From Genome Similarity Track
Location :
Scaffold_74:607- 1988
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G014817Similar to Tf2-1: Retrotransposable element Tf2 155 kDa protein type 1 (Schizosaccharomyces pombe)

Sequence
1381 bases(100 bases per row)
CGGAAGGTAAGGCTTTAGTCTACCCACATAAAATGTAGGATGTAGACGCATGCGTGTAGGTATGTCTAGTGTGTAGGCATCATCATTGCATTTAACTACC
CTGAACGGTCCAATATATCTTGGCAAAAGTTTCGAACTTCCCAAGTTAGACACTGCATGTTCAGGCAGATTAGCCGTGCTAAGCAATACAAGATCGTTGA
CCTTATATACTTGCTTGTTCTTCCTTCCACTCTTATCTGCTTGTTCCTTTTGCAGATCCTGAGCTTTTGCAATTGCGTCTCGAACAAACCTTACAATGGC
TTGTCTTCTCACAATAAAGTCATCGACTTGCTGTGCCTCACGACTTGTCATGTCGTTTAGAGGTTTCATCGAGTCGAAATTGGCTTTCAACTCGGCAACA
GCATTCAGGTCAGTGACTGACTGCGGCTTATTTCCAAGAGCCGTAGTCCCTCCCCCACTCAAGGTAGAGACCTCACCCATTATGGAAGCACGCACTCGGG
GATGAATGCCGTAGTTCACATAAAATGGAGAGTGACCTGTCGAGACATGCGTGGAGTTGTTCAACGCAAACTCAGCGAGAGGGAGAAACTCACTCCACTC
TCCGAAAGATGTTGCATAGATGCGCAATACATCTTCCAGGACACGATTCACTCGTTCAGTTTGACCATCCGTTTCCGGGTGTGCTGCTGTTGACATGGAC
AACTTGGTGTCCAGAAGTCTGAACAGTGCACGCCAAAACTTGGATGTGAAACGAGTGTCACGGTCAGACACGATCTCGACTGGTAGGCCATGTAGACGGA
AAACAACGTCTACAAAGACCTTGGCCGTCATTTCGGCTGAGATCTTGTCCGAAACCGGTGCAAGATGGACCATCTTACTGAATCGGTCCACAAACACAAG
GATGCCATTGCGTCCGTGTTTGTCACGAGGAAGTCCGAATATGAAATCCATACTCACAGACTTCCAACTGTCCGATGGGACAGCCAATGAACGAAGTGGG
GCTTGCGTGGAGCCAGATGGCTTCACACGCTGGCAGATCTCGCAAGTTCTCACATACTTGCGAACCCACTTGTACATGTGTGGCCAGTAATAATCCCGGG
AAAGACTGAGAAACGTTTTCTCACGTCCGAGATGGCCACCCGAAGGACTGTCATGGTACTCATACAAGAGTCGATGACGTAAACCTTCATCGTTGGGAAC
AACAACTCGTGCTGTATCCTCAACTTCCACCGCATAATACAACAACCCATTGTGTACTCGGAAGCGGTGAACGCGCGATCTTGTTCTAGCAGGCAAGCTC
TGCAGTGCCTTGTCAGAAGGGTCTTTGAAGTACTTCAACAAGTCCTGACAAGTTTCGTCAGACTTGTACCCTTCGACAATC