Description :
From Genome Similarity Track
Location :
Scaffold_467:607- 1897
Sequence
1290 bases(100 bases per row)
TTGTTCCTCAGTCAGCTCGTACAGGACGGCCGCGATCACGGGTAGATCTTCAATGAACTTGTTGTAGTAATTCAGACTCCCCATGAAACTCTGGACGCCA
TTCAGTGTCGTCGGGAACGGCAAGTCTTGGACCCCATTCGCGACTTTAGGGGTCGCTCGGATACCCTCAGCACTAATCTCGTGCGAGAGGTACGGAATGG
ACAACTTCCCGAATTCACTCTTGGGAAGACTCACAGAGATATTTCAGTAACGTAGTCGGAATAGCAGCGCGTTCAGATCCTGGCACAGCTGCTCCCAAGT
AGGCGCACCGTGGGCGATGTCGTCGATATACGAGCTTCGACCCAGGACAGGGCCCATCTGAGAGGGAGCCGGGATGTTACGCTGAAAAACAGTCATCTCA
TCCGTCAACACTGAAAGTCGCGATGCATTTTCCCCTGAAACTCTGGGTTCCCCAGAGTTCAACCCCAAACACTCCAAGACATCCTGGTCGACCTCAGCTT
CTTCCTCAGGGGAAAGCCGCAGGAATCCCCACAGACAGTTATTGTGAACTGCCTGGTAGATCAACGGCGCGTTCTTGAGGCCAAAACCCTTTCGGTCTCA
AGAACGCACCCCAGATTTACCAACGTCTGGTGGACAACGCATTGTATGGCTTCCGTCGAATTCCAACGGTCGCTGGCGAAGATGTCTTTGAAGAGGGCGA
GACCGGAGACGCTTTCGCACCACCCGTTCTGGGACGAAGATCGTACATCGATGACATCTTGATCGGTGGGACGTCTTGGGATGATTTATGTGAGAAGGTG
GAACGTTTGCTGGACGCATGCGAACGTTGGAATCTGTCTATCAGTGTCGAGAAGAGCTACTGGGGTATGGACAAGGTCGACTATCTTGGTCACTCGGTTT
CTAACCGCAGCCTGGCAACACAGTCCAAGAACGTGGAAGCACTGACGACTCTCGATTTACCGCGGACGTTGAAAGGGCTCCAGTCGTTTCTGGGAAGTTC
GAACTACTACCACCGTTTCATGGGTAACTTTGCGGTCTACGATGCAGCTCTCTATTCGCTGACGGAAGAAGATTTCGTGGCGCGACGGAAGTGTTTAGAT
GAGAAGCTTACCGAATCGGACGAAAAGTGGTACCATGCGCTGGCTGCGTTTGGAGTGCTCAAGGAGAAGGTGGCGCATACACCCATCCCACGCCATTACG
ATCCGGAGCGGGAACCCGTTGTCATCTTGAACGCGAACGATTGGCCCGTGGCCGCAGCCCTGGCTCAAGCGCATGATGGCGTTTAACTAC