Description :
From Genome Similarity Track
Location :
Scaffold_16:60690- 63760
Transcript NameFunction/comments
Pytul_var.sporangiiferumsnap_masked-pug3_contig_16-abinit-gene-0.70IBR domain protein
Pytul_var.sporangiiferummaker-pug3_contig_16-snap-gene-0.37IBR domain containing protein

Sequence
3070 bases(100 bases per row)
GGGAGTTCTACGGAGGCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTGCTGTCTTGGAGATGA
TGGGGAAGGCCGACTGCATCAGCTGCTCGAACATGGAGCGCAAGCGCGAGCTGCGCGTGATGACCTGCGGCCACTTCTACTGCACGGAGTGCATACATCG
CATGTGCCGACTGGCGCTCGGCGATCGCTCACTGATCCCGCTGCGCTGCTGCCGCAAAGAGATCCCGATCGACTACATTCGCGAGGCGCTGCCGACCGTC
CAGGACTACCGACTGTACGAGAAGTTTTTGCGTGAGAAGAACTGGAAGCAGTCGAACCTGGTGTCGGACTCCGAGTACGCGAGAGTCGTGCTGTGCGTCG
GCGGGAAGCAGTGTCCAGGGTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCCCGAACGGCCACGAATTTT
GCTTCACGTGCCTGCGCGTGTGGCAAACGTGCTGCTGCCAGTTGATCCCCNNNNNNNNNNGAGCCCGAATTGCGCCATATCCTAGGTGAGTAAACAGACC
AAAGTCAATAAAGAGAAAGAGGTTCTGCTGCCCAGTCCCACGCTGTTGGCTTTCAACGGTGCGATCCATTCCCATCGCCTTGTTCGACTTGTCTGCTTCT
CCATTCGCGGATTGTGCTCTATCCCAGAAGCGCATGAATTGCCGCGATTGTGGGCGCGTGCAGGCTNNNNNNNNNNGTCAGCCCCTAGTGAACGACGTGT
ACTACCCGTTGACCTGCGGCGACACTTACTGCCGCGCGTGCCTCGCGAGCGTTGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGTCT
TCATGTACACGACCTGATCCCGCTTCGTTGCTGCCATCGGCGCGTCCCACGCGAGTGGATCGACGAGGTGTTGGAGAAGCCCGAAGCCGGGTACTATGCG
TTTCTGCTGGAGAAGAAGAAGAGTGCGTTGCCACGGGATCAAGGCGCAAATGCACCCGGAGTACAGTTTCTGAGGAAGCAGGTTCGGTGCAAACAGTGTG
ATGCTGCGGTGGATCAGAGCACAATGAAGAAGATGCCGCTGCTGTGTGGCCACGTCTATTGTCTCAAGTGTCTTGGCGCGCTCTGCGAGATTGACAAGGA
AGACGGAGTCGCTCCGACATGCTGCAATCTGCCGATTTCAACCGAGAAGCTGATCCAAGTGGAGAACGCGAAAATGTTGCGGCTCGTATCAGCCGTCGAC
AATGTCAGTCCCAGCAAGAACGCGGTGCCAGCGCTGCAAACGATCGTCATTGATGACGATGTCTCTGTGGCAGCAGTAAATGTGCACGACCTCACAGCTG
AGAGCCCGAAGCAAGGGCGGCGTCAAAGCAAGCGGATTCTGTCGCTGAGTGGCACTGGAAAGCAGAAGACGTCACCACAAGCAGCGGCAAACGAAGTCAA
CTTAGTCGATGCCTCGGATGCCGCTGAAAACACTACAACAACAAACGAGTCGACTGCTCGTCCCAAATGCTTTACGTGCAACAAGTTTGTACTAACGACG
GACAGCGCGTGCGGCCACAGCTTCTGTCTCAAGTGCATTGGCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGAACGAC
AACGACGGCGGTATTGGGCTTCCCCTACGTTGCTGTGACGAGCTGCTGCCTCTGGAAATGATTCGGCCAGCGCTCAGTCGTCAGGCGTTTGCCAAATACA
AGGCGTTGGTCGCGAAACGCGAAGATGATATCAAGCAACTTACAAAGCGGAAACGAGACAATGGCAAGCAGAAGGCGGCTGTATTCACTGTTACCAAGAA
AGCTGCTGCTCCACTCGCAAAGAAAGCGAAGGTGGCCACTGATGCAGATGATGGGGAGAAAGCTCCAACTCCACGCGAGGACGAACCGGTCGAATGTGTC
GCGTGCATGGACCAGATTCCAGTCTCTGGGGACCAATTTCGAGGTCCGTGTGGCCACGTGTACTGCTCTGACTGCCTGACGTTTATGGCGAAAAAGAGCC
TCAAGGACCGTGCGCTAGTGCCGATCCGCTGCTGCGGCAAAGAGCTTCCGATCGACTACGTGAGTCGCGTGCTTTCAAAGCGAAGCATGTCCACGTACAA
CCGGTTTCTGCGCGAGAAGAACTGGAAGACATCGAACCTCAAGTCGGACAAGGACTACGCGACGCTCGTGAAGATAATTGGCGGCAAGCAGTGCCCGAAA
TGCGGCATTGGCGTGCAGAAGATTGCCGGATGCAACTCGATGGCGTGCTCCCGCGGCCATCGCTTCTGCTGGGCCTGCGAAGCGCACCCGTGCACGTGCT
ACAGGAACCTCCGAGAAGCCTATTATCCTTAGCAGTGTGGTAGCTCTTGCATGTCCGTCGTCATGGGGTGCTGAAGGATTTGTGCACGCGAACGACAACT
AGATTTGCGTATTTTGCATCTATTGATACACACTTGGTGTCCCGATGATACAGTCATGTGCAGAGTCGATCTCACTCTGCTTTATAATTTGTGCGCCAAT
TGGCAAACGCAGATATCCGATCAACATCCATTTTCAAAGAGAATCTGTCTGAGTTTTTCAAAAAATGTGTGAATGTTGTGACACTAAGCATTTAGAGTAA
TGCGGGGTACGGAATGCCGCATTGTTGAACTTTCCAGCCTCTCAGTGCGGACTTGTTCTTCTGGGACACTTTGGATGTTTCCAGGAATGGATTGCAACAA
GACTCGAAGGGGTGAATTGAACTTGAGCAATTTTTGTGAAGGCACATTGTCAAAGTTTCTGTGAAAAAGGAACATGGTGAGACTGTACTGCGTGGTCGTT
TGCGAGAAAGACACCATCGCCATCGCCATTAGCCGCCACAAAACAGTTGCGGATTTGAGGGTCGCGATCAAGCGTGAGCAGCAGTACGGTTTCCCAGCGA
GCAAAATCGTTCTGTATGTGACCAAGCAAGACGGACAGATAGATGGCGCGTGGGTGGATTGTGAAGATGA