Description :
From Genome Similarity Track
Location :
Scaffold_7:60683- 62521
Transcript NameFunction/comments
Sapdi_VS20SDRG_02921TKL protein kinase

Sequence
1838 bases(100 bases per row)
GTGCTAGCATGGACAAAACCAGTCCACAACGGTGCCTTCTCTCGATAGACGGGGTTCATACCGAGCAAGCAACGGCCACGAGAACTACGCCGCGTCCCAA
CGTTTGGTGACGTTCGACCAAAGTGGTTTTCTCAACTTCCATTCAAACGCTTGCAAAACTGGGTTCATACGCTACAAAGCAGTGCCGTGAGGGTCGCGAC
GACGGCGTGGGCCGCGGGCCGGGCCTTGGGGTTTGGGTGCAAGCACAAGTCGGCGAGAGCAACGAGGCCGGGTGGACACGACGCGCCAAATTTGGGCTTG
AGCTGGCCGTTGACGACGCGCTGTAAGATTGCGAGGTTGGTGAGGTCGTTGCCCGACGCTGTGCGCTCGTTTGCAAACGGAATCTGGTGCGAGTCGAGCT
CCGAAAGGACAATGCCAAAGGCGTAAATGTCGGCCGCCTTGGTGTACGCGTCGCCCGTGAGCACCTCGGGCGCCATCCAGCGCGACGTGCCAAAGCCGTG
GCTTGTCACGTCCACCGTGTCCTCGACCGTCGGGTGTAGCTGCAGCGCGACGCCAAAGTCGCACACCTTGGCACCATTCTCGCTCGGGTCCACGAGCACG
TTCTTGGCCTTGATGTCGCGATGAACCATATCAAGGCTGTGGAGGTACTCGAGGGCCTCGGCAATGTGCAGCGCGTAGCGCACTTTGGTCGACGGCCACT
TCATGTTCGGGTCCAAGTCGAGAAGCGCGCGGAGGTCGCCGCCGGCCACGTACTCGGTCAGTAGCATCATGTCGCGCTTCGACTTTGGCCACGCCGCGCC
AATGCAGCGCACGATTCGTGGGTGGTCCAAGCTAGTAATAGCAATATTGAGACGCTGGTCCATGTAAACCGAAGCGAAATGATGTAGAATCTACCTCGCG
AGCAGTGTAATCTCGCGCAGAAAGGCCGCAATGTCGCTCTGACTGCGCTTCTCGGGCAATAAGATCTTGATGGCGACGACCGACGCGTGGTAATGGCCGA
GCCAAACCTCGCCGTAGCCGCCTTGGGCCAATCGCTTCTCCATCGAAATAGCGTCGCACTCGAGGCGCGGAACGTTGTGTTCAAAGCGCGTCGTGAGCGG
CGACATTGCGAGCGACTCCATGCTGGCGTAGATGACCTGCTCGACCGAGAGAAGGCGCTCGCGCTCGCCCGACGAGTGGCTCGACGTGTACTGCACGCCG
CGCGAGTAGGTGCGCCGACGCTTGTACACAAAGCAAACAAAAACGCCGACAATGGCTTCAATAATCCCCGAGACGAGGAGGAACCAGCTGAGCGTCGAGT
AGCTCCAAAAGCCAGAGGCTGTTGGTGCCGACGTGGGCAGCGGCGGCCCGACCGTCGATGTGACGCAGACGATATTGCCTTTGAGTGAGTGCGCTTGGTC
GTCGCCGCAGTCGGCCGCACCACCGGGCGGCGCGTCCACATCAAAATAGTCGAGCGCCGAGAGAAATTCAAACTCGTTGTACGTGATGCGGACGGGCACC
GGGATCGAATTGCTTGCGAGGTAGAGCTCGGCGAGGTCGAGCATGCCATAGATGCAGTTGGGTATCGCCGACAGCGCATTACCCGTCAAGTCGCTACAGT
CCAATGTTTGAGTGCTATAACAATTCGAGGAAATACATACAGACGGCTGAGGTTGGGCGCCGAGAGGTTGAACGTCGTCAAGTTGTTGTTCTTGGCATTC
CTAACAGATCGTAAGAGAAGGATGTGGCATGGACGCGCACGTACACGGCAACGAGGTTGGTGTATGTGATGGTCGATGGCTTCTTGGCGATCGAGACAAT
TTGGTTGTTGGAAATGTCGCTACACGCGAATGAGATGA