Description :
From Genome Similarity Track
Location :
Scaffold_691:6068- 7263
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_691-fgenesh-gene-0.1WD-repeat protein
Pytir_DAOMBR486maker-pir_contig_691-snap-gene-0.10Protein H39E23.3, partially confirmed by transcript evidence

Sequence
1195 bases(100 bases per row)
ACTACGACAACGGCGAGACGGTCGGGCTCGGCAAGGGTCACAGCGAGGCGATCAACGCGGTCAAGATCTCGCCTGACCGGAAAGAGATCGTCACTGTCGG
CTCGGAAGGCGCCATCATGGTCTGGGAAGTTGCGGATCTGCTTTAGCTTCTGCGTCGAACCTCGTTCGTGAAAGTGGAGGCTCTGTCTGGCACGCCTGGA
CCGCAGTAGCTTCTCTCAGGCAGGTAGGCAACAGACTTCTCTCTTGGAGCAGCAAGCTTGAGCGAGTCGTACCCACGTACAGTTGTCTCTCTTCTTAATC
TATCACTTGCACACAAACCTTCACAATGACAAGGGAGGAGGGAAAACTGCCTGTTGGATTGTTGACATTATACGTACACACACCTCATAAATACTCACTC
AACGGCGTGTTGGCAGTCCATTCTGGAGTAAGTCCAGCGTGTCGGATACTGAGGCTCGACTAGAGAAAGGTGGACGCTGGAGCAATCCAGCAGACTCACG
ACCGGAATGCGGAGACGAATTTCTCGATGACTGCAGTCCAGAAGCCACCGCCTGTGGTTGCTGCTTAACTTTGCAACGCATGCAAAATTTTGCATCAGGG
TCACGTAAATGCACCATATCACAGAAAACACAGCCCTCGGGTTTCTTACTCGCATTACTGAGGGCATTGAAGCTGGTGCTGCTGCTAGTAGGTGCTGGAT
GTTTTTGTGCGCCTATGGTGAAGTACAGCGAACAAGTCAATCACGATCCCACGCGAACAGACCAACAGCCAACAGCCATGTACAAGAACAGCCAACTGTA
ACAATGCAACACAACCACGTACCATCACCACCGTCACTGCTGATCTCCATGTCTTCTTCCGTCACGCTATGTTCAGACTGAGTCACTGGTGAAAATGTGC
CGTCTGCATTGCTACTAAAAGAATCGTCTCTCACTCGTGCGATCGTCATCTCGGGGGTGTCGACAATCTCCGCTACTGGTGGTGCTGACGCTATGCTGCT
ACTTCTGCTGCCGGTGGATCGAGGTGGTAGAGGGTCTCTCGGACTGGAACGTTGGGTGGACGACTCTGCGTCGCGGTTGTTCTGCTCGTATCTTCTATCC
ACACTGTATTTCTGGTTGTCGTTCAGGATCTCGAGACTGAGTAGAAATTTCATCGCGTCCTCTCCAGCAAGTCGGAACGCCTCTTTCTTCTCCTC