Description :
From Genome Similarity Track
Location :
Scaffold_174:60654- 62051
Transcript NameFunction/comments
g7766.t1hypothetical protein

Sequence
1397 bases(100 bases per row)
GCGTAAATGCTCATAGCTGTTTCCCAGAACACCATTACTTCTTTCGCGGTTTCGGCCATAAACACCACTTCGAATCAAGTTAATATCACGAAGGTCATCC
GTAGCTTGATCATTGCGCTGGTTCAGGAGTGCTGCCACGTCAGAGCAGGTTCGTGTGGTGAGCAACATCGCTAGGAGACACGGGTTGGGACCAACACATT
TCTCTAATTTGTTCAGCAAAACGATTTCTGAATCATTCCACGGCTTTTCCTGCTGTGAAGTATCAAATCCGTTGATTTGATCAGCACTGATTGTACCAGA
GACGGGTTTTGAGCAATACGGTCCACAGCGAGCTTCAGCAGACAGAAGTTCCAGCCTTTTATCCTGAGTAAGCGCTTGATAAACACTGTTGTAGCCAAGG
TATTCTGACACGTCTGTTGTCTTGGTCCTGGACACCTTCTTAGTGGGAAAGCGAGTAGCATTCAGCTTCGACGAGGCCTTTGTGCTTGCAGCGGTTTGAG
CACGAAGTGATCTTCGCATCGACTCGCGCGCGGGATCATTATCAGTATCAGGATCGCATTCAGTGCTAGCAGTGGGCGCTAGTTCCAACATTGGCTCCGC
TTCAGGGCTCTGATCATCATCCATTAGTACATCCGTGTCTTCAACAGAATCCTCCGCCTGTTCTTCCGCCATTAGCTCTTCCTCAACACGACGCCAAAGC
TTGGAGGAAGCCTTCACTGACGGATACTTCGGGTCAACGCGCACCACTGGAACGGGTTGTTCACGACCGTGATTTCGACAGCTGTACATACAGCAGCGGC
GGCAAAAGAAGTCCTGGTACTTCATAGCCACGTCTCTGTATTGCTTCGATGGAGCGTCTCGCATACCCAAATCTCCATTCTCCTCGAGGAGGTTCCATAC
CACATGCGATGGCACCGGCTGCAAGCGGTCACGCAGGTGTGCTCCTGATCGTATTGAGTTGCATTCATCCAGAAGACTGCTTAGCGCTTGCTTCCTGTGC
GCTGAAATTCCATCGCTGCTCTTTAGAGCTTCCAATTCGTGTAGACGCCTCGTATACAGTTGCTCTCTAGTGACACGCTCGAGGATACCGGAATAATGTG
CGAACGGTTGTGCAAAAGCTCCACTTCGTTGGAGCGCCTCAAAGACTGTCTGATCGCCTCCACAACTGGCCACCACATATCGCAATACGTACTCGTTGAT
TTCGTCATCCATTCCTACAAGGGTATCCTTGCAACGCTCCGTGCTGCTGACCTGTGGGCCCTTCGCCTTGGACTTGCTTCCAGCGCTAAAATACGGAACG
AAACGAATAATAGGGTCATCCTCGACACGATGCGTTCCCCGCGCCAGCATGCACGTCGTGGAGCGTGGGATCGGCGCTATTTTGCTGAGATACGTCA