Description :
From Genome Similarity Track
Location :
Scaffold_7:606523- 612911
Transcript NameFunction/comments
Physo_129340reverse transcriptase

Sequence
6388 bases(100 bases per row)
ACCTTGGTGTAAGGTACACCAATGGCTACATACATTTGGGACCACCACGACGGGTGGTTCATACACGTTTAGGATTCCTATTGGCTGAAAGCAGCATCTT
TTAGCGAATGAGCGACTTGCATGTTAGCGGAATCCTGCCAACCAGCCGTTGGCAGATTCCTAGTTTTAGAATATTACATGTAGGGGAAGTCAAACCATAA
ATCACAAATAACAGTTCTCATCTTTACCAAAACACGCTACTTAAAGTCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACTTAACTCAAGTA
AAAGAAACCTATGCTTCCTCATACACGTGTGCACACGTGTAAGCCGTAGTAGCGAGCCAAGGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCC
AACGACCGACTAGCTGAACGTTCGTACGGAGCTGTACGAACGAGGAGCCGAGAACCTTTTCCTGAGCGCGGAGGTGCCCATGGAAAGCTCCACTTCGCCT
GCAACTCATGTTGCACGCGCTGACTGCCTCCACCTGTCGGATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTCATTGGGGAGGCGGCAGTAGCTG
CGATGCTGCGTACGCTATCGCCGACAGAGCAACATGGTGTTGCTCTGGGATTCATCATGAAGGAGCAGCGTGATGCTGCTTCCTCTACCACGGTGGCGTC
AGAGACGACACCGCGTGGACAATCGTTGAAGCTAAACGTGAGCAACTATGTCGGAAGAGAGGGCGAGCCTCACCTCCGTTGGCTTGTCGAACTCAACACT
GCCATCGCGGCTAGACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGCCGAGCGAGAAGTTGGGCGTATGGACGCCGAC
TCTCTGATCCTACGTGCTGAAGCACGTACGAGGGATTCAAGGAGGAGCTCAGACAAGCGTTTGAGCCCCCGCAAAATGAGTTTCGGTCGAGGGCAGAGTT
CCTCGACCTACAGCAGGGTAAGTATGATGTTCATGCTTACGTGCAGAGAGCACGGTACTTGGTCTCGAACATTGTGACCAACCCGATAGACGAGGCGACC
AAGGTCGTCACGTTCATGAAGGGTCTGAGAGATGGGCCTGTAAAGACCTATCTCTTCCGTGAGTACCCAGGTACTCTTGAAGCTGCGACTACTCTTGCGA
TGCAGGAGGAGTTTAGTCAGAGGCAATCTAAACTGCATGCAAATGCGCCGATGCTGCAACCGCCTCCGGTCGCGATAGCGGGAGGTCCGTAACCAATGGA
CCTCTCGAGTGCAACGGCTGTTGGCTATCAACAGCAACAAGGAAGTAATGTATGATGCTTCCGTTGCGGAAGGATCGGTCACTATGCCCGAGAGCGCACG
GCATACGTGCACCGATATGGTGGTCTACGCGGCGATGCCGGGCATCGTCGATGACAAACAAAAAACGCTGGAACCCAGTAGGCGCGGGGCGCCCTACTGG
GGAAGCAGTCACACGTCTCCAACTCGGACATGCGACACTGAGGACTGTAGCCCCCAGTGAGGACCCTTCTCACGGCAAAATGCGTGGTGACAAACCGAAC
CTTGTCATCTTGAACGTGTCTTCGAAGAGAGAGAGCAACTCTCTTCGTGCTTTGGTTGATTCGGGCGCGTCGAACAACTTTGTTTGACTGCGAAGTCTAT
CAAGGCTTGACTTCGAGGAGGTAACTATACCTCGAAGTATGTTGGAAGTTCGATTGGCAACGGGGGCCATCGTTAAAACCTTGAAGCGCATGGTACGCGT
GCGCTTCACGTATGGAGATCAAGAGTTTGTCGAGACCTTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGTATGCCGTTGCTTGCACG
GCATGATTGGGTCATCGATTGGGAGAAGCACACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGCCGCTACGCACGCACCG
ACAGGTGCGCGCGACTCCCCACTCGAGACAGCGCCTAACGCCGCTGTCCCGGAGTGCCCTACGCGCGCGAGCACGCACACAAGAGCAACTAGCGTCGGCG
TTGCCGCCGACAGCTAATAACGGAAATCTGTTGAGCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGAAGAGTCTCCGGCCCCGAAGGGCACGGATG
ACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGTTTTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGAC
TCCGGGAGGCCATGGATAGGGTGAATTTGATTCGTCGGCTCCGGGAGCCGACGCACCCTCCGTCATGGGGGGTCTCCGCCAATGGTTGGCGTCGAGGTAT
TACAGTCGCGACGGTTCCGGGAACCGGCGCTGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGCTCGCCCGCGGGATATATCCGACGG
CTGTATTACAGAAGAACACCCGCCCACGGCTGGGCCTGGACGAGGTCAAGACCCAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGG
TCGCTGCGCAAGTCTCGGCCTGGGGCCGAGACGCTATAAGAAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGA
CGCGTACCTGTGCCGGGTTCCGGTACAGGGAGATGACTCTCGCTAATCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTAGAAGCG
CTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTTTCTCGGACGCCGAGAGAATGAAGAGCGAGAATGAAGAACTGAGGCAGTTCTTC
ATGGAGAGCACCACTGAGAGTGAGGACACTCTCGGTGCGAAGACGAAGAAGGAGCGCTTTGAAGAGCAGAGCTGGGACTCGTTGAAGACGAGCCCCTACT
ACGAGAGCTTACGGGAGTACGCGGACGTGCTTCCGGAAGAGATCCCTGCGGAGCTTCCGCAGGACAAGGGTATCCAGCACGAGATTGATCTCGTGCCGGG
CACGAAGTACTGTGGCACGCGGCAGTTACCACTGCCGCGAGAGCACGCCAAAGCGATCGACGACTTCTTCGAAAGTCGTCACAAAGCTGGACAAGTGCGG
GAATCGAAGTCCCCGCACAGTGCTCCGACGTTCTGTGTCAGGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGTTGAACGATGCGACGA
TACCGGCGCAGACGCCGATACCTCGAAAAGATGTCATCACCGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATGGGTTCTATCA
GGTCCTAGAGCGATATCCCTTTCACGGCCTCTGGGAGTGGCTAGTGATGCCGCAGAGTCTTAAGAACGCCCCTGCGACCTTCAACAGGTGCGTGACGCAC
TTGTTGCGCTCGGTGCGCGACTTCGCACCGGCTACTTCGACGATGTGTTCGTCCACAGCACAAGGTGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAG
CACAAGCTCGATGCGAACCTGAAGAAGTGCATCTTCGGGGCGAGCGAGATAGCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGAACCTG
AGTGATCATTGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGACAGTTCCTTGGCTTGGTCACGTACTTGTACAAGTATGTGAAAGACTATGCTGGC
ACGATTCGCCCGCTGTCACAACTTCTGAAGAAGGAATCGGGCTGCTGAGTGTCAGCAGGCCTTTGATGCAGTCAAGCAGGGCTTGGCTGAGGCGCCGATC
TTGGCGGTGGCCGACCACGATCGCCCGTTCCACGTTGTGTGCGACGCATCCGACTTCGCAATCGGATGCGCGTTGATGCAGAACGATCACGAGGGTCATG
ATCGTGTCGTCTACTACCAATCGCGAAGCCAGCTGAGCGCAACTACCCGGTGCATGACAAGGAACTCCTTGCCATGAAGTACGCACTCGCGAAGTTTCGA
ATGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACGGACCACGCGCCGCTGCGGACGGCTGTGAAGTCGCCGCACATTTCGCAACGGATGGCGAGAT
GGCTCTCATTTTTCGCAGAGTATAACTTCCGGGTCGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTATCTCGTCGACCTGACTACGCCAC
GACTGATGCCGACGTCAATTCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCACTGTTGGACGGCGTGAAGGTCCCGTACGCGCACGACGCGGAC
GCGAAGCTCTTGCTGGCCTACGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACG
GCGGGTTATTACTCTACAGTGCTGTCGACGACAACGCGGACCGAGTTGTCGTGTCCAATGATCATGACCTGCGACTCAGGATCATGTACGAGTATCACGA
TGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTTCCACTGGGCCCACCAGTACAAATGGGTGCGCAAGTACGTC
CGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTACAGTCACTACCAACTCCACGAGAGTGTTGGCAGTCCATGTCTT
TAAACTTCGTGTTCGGTCTTCCCCCGGACAGTCAGGGGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACC
CGGTGAAGTGACTGCGAAGCAGACTGCACGTCTGCTCGTCGAGATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGC
TTCACTGCACACCTTTGGCGAGAAGTTTTTACACTTCTTGGGAGTCAACTTTCAATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCG
TGAACCGCGTGCTCGTGGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGT
ACATGCCTCGACCGGGCATACACCGTTTTACGTGAATGCCATGAGGCACCCACGCCTCTCGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGA
GGATCTCCGACTGCAACGCAGCAGCCGAAGACTGTCGCTGACAGTTGCACAGTGTCAGCCGCGACCACACGCAAGAAGAACAAGAAACACGCGTCTGTGC
AGGGCACAGACGCCAACAATAGCAACAACAATAGGAAGAACGGGTCTGTGCAGGGCACAGACACCGCCAACATGGACGCAGAGGCCGGGCCTACTGCTGG
AAACGAGCTGAACTTATCCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCGTTCGGTTTGTCCAAGACGCTATTGCAGCTTCTGTCGGT
CGACAGAAGCTGAATGCAGACAATGTTGGCAGGGGCAACACTAATAAAATCGAGAAGGGTTCATTAGTCTTGTTAGCTACTCAAAACTTGCCTAAACATG
GCGTTTCCGACTTCGGGGCAAGCAAGCTTGCTCCGCGCTTCATCGGGCCGTTCACTGCGCTGGCACGGCACGGTAACGCCTACACACTGGACATACCGTC
TAGTATGCGCCTCCATCCGACGTTCTACGTCGGACGACTGAAGCCATACCTGCAGCACGAGCTACCTAGCTCGGCTGAACCGAACCAGAAGACTCGGCGG
AAGCCGTCATCCTCTCCAGTGCGAAGTCGCGCTGGAGCAGCGGGTCGAGCTAATGGTACAGCTCGGCCGGAACGATCGAGGCGGTCTGGGAGGCCACCGC
AACCTGAGGATACTTCAGAACGCCGAACTCAGCGCTCTGAAACTACTCCACGACCGGAACTCGGTCGTGGGGAGGCGCGAGATCAGGGTCAACACCAAGT
TGACCACACACGGGACGTGTTTACACCACCACTGCCGCCAATTCGTGACGCACACGGCTCAACTGGATGGATAATTGAGCGGATTGTTGGTCACAGTATC
CCGAGAACGAACAGGCAACCGGTTCGTTTTCGTATCCGTTGGAGAGGATTCCCTCCCAACCAAGATACATGAGAGCCGCGGAACGTCTTGCTCGAAGACG
TCCCGGACATGGTGAGGGCGTACGAAGCCCACCATGCGCTACACGCTGGAAAGTAATACGAGCGCTGTTGTTAACAACAGCGCCCGAA