Description :
From Genome Similarity Track
Location :
Scaffold_61:60649- 64606
Transcript NameFunction/comments
Hyaar_Emoy2807247hypothetical protein

Sequence
3957 bases(100 bases per row)
GGTTTTCGTAGATTGTTGCGGCCATAACCATTACATTATTGTACGCAACGTGTACGACACTTCATTGTCGCGCTACTGCAGACCCACTTTCATTCCTTCT
GAATAGAAACCCTGCGAAAAAATTATTGGGTTTCGATTATATTTGTAAAATACGCTCGTTAGATATGTAACAATCGCATCTATAAAATTCTATTAAATCG
CATATCGTAAACCTCGGGCTTCTCCTTGTAGCATATAACACTTTATCTCATCTCCATACCTAGTCAGCATCAATCTATTGCAATCACTCCTAACTGTTCT
ACTTCGTACGAGACCGAGTCAATTTATTCTCAATATTCTGAAATAATGTCGCTGAAAAGGAACGGCTCCAGGTTCGTAAGTATAAAATCATGTTAAATGT
ATGCAATATTTCGGTACGCTCACAAGGGCACGTACAGTTTACACGGCTTTGTTACATGCTAAGACTAAGCTGCTAGCATAGTACATGATTTTCATGCAAA
AGAAACCAAGTAGGCGCGTAGGTAGTACCTTTGGTGAGGAAAGTTTTGTCTGATTGAATCGCGTGTTTAGATGAACTTGTACCGAGATAGACATTAAAGC
AATTGAGGGTCATCGTTAATGCTTGCCATACTACTACGCAGAAAAGAGCGTCAACATGTCGATCTCATAAGTTGGGGATGCGACATCAGAAAGGTAGTAT
GATCCACTGACCACTTGTTTAAACTGCTACCCAACCTGGAAAAATGAAGGTGCGAGCTGTTTGACACCGAAAATGTAAAGGTATGGCGTGAGTCCGCACG
TGCCTCGCGTCCCAGCTCCATATTGACCACACTAGAGTCAGGGACACGACATCTCCTCCCTCATCACAGATTCTACTCAGAAACTACGACTAATGAACGC
AAACACTTCTTATCAACATTATTCTCGTGGAATTGATCATTATAGCCCTCGCAGGTGCTTGTTACCGAGTATGACATACAATGTAACGTTATTTAAATGA
TCTTATCACCGTGGATGCTAAGGATGTTAATTTGATGAATTTCTGCCAGCGTTTCCTGGATTGGGCCATTGATGCAGCTGTATGCATTAGTTGTGGTCTT
CGTTGCGTAGATGATTGTTCTTTGACTTTCACAATCGTGATAGTAGTATTTTCAATCTACTGGCTACAGCCATCTACCAGAGCATACAAAGCAGGGGGCG
GACAAAGTGGAAGAAGCATCAACTGAGCATCGCCTTGGAGAATAATTTAAATCCAAAGGGAACACCCCTGCAAATTATACACTACGATCTCAACACGGAT
TGCCGATGACAGCGTATTTCGGCAAGCTTCGCAAGATTCCATACAGCATTAACGTGCTGATTGAAGCTACTCTATGCTGCCAGCTAAGCGATGGCAAAAA
AATGCAGATTATTGTTGTACGGGCAACGAATCAATTGCCGTGCTTGAGGTGGCTATCGCTATCAAGTCGCGCACTAAATTAACTTTCGCCCTCGATAAAC
GAATATCGAAACGATGTATCATCCCTTGATTCCTTAATTCGATGCGTGTCAACGGAGCATCAATGACGGGAGCTGCTCCAATCTGCCGACATTACACTGT
CTCAGCACGTTTGGCTGGCACATAGAAATGGCTGACAGATGATCAGGACATGGAAAGGTCGACTTCTCGGCTGAGCACCTCAAAAAAATCGGGCATGAGC
AGTTAGACACAAGTTGAAGTGTAATACTGATTGCAATGTCGTTGTTCCTGCATTTTATAACCAAAGCTGTCATAACAGCGATTTCTACTTCGTAATAAGC
CGTAACGTCGGCGTTCGTCTGAAGGCCGCGCCAGGATTCAATCAAGAATTAGAATCTTGATGCCAGATAAGTCCATCGAACAAATATCGGTAGAATCGGT
AAGCCCATGAATACAGGTTCCGTATTTACATGAATGTGTTTTTGAAAAATTCTTTCTCGATTCACTACGAAACTGATCGTGCTCATCGAGTTCTTTAGCC
ACAAGCCAAAGGGTACAACGGCTTTCGTTCTGAACTGTTTGCTATAGCCCTTGAGGCGGTTTCTATTGATGAGGAGTTAGTACCGCCCGGAAAACGTCGT
TTCCCCTTATTCACGTTCTTTGATGAGGCATACAAATGTGGGGAGAGCTCTTCCGCCGACTATACTAGACAGATGACAGCGGCGACTCGAGCTTTGAATA
ACACCAGCTGGTAATTCACGCACATTGTACAGAACATGCTCAGCAAGTTGAAATGGGCTCTGTTAAAACCTTTGAATCTATGGACACCTCGCAGAGAGGT
GGTGTTTACGGATACAGCCGCCATACTCGGTTCACCTGGGTCGCAGGTTTCCTACCGTGATTTCATGTTCAATCCATCGCTGTACAGCAAGCCTGACATT
GTGACGTTGCGGTCTCTCTGCTAGTAGCCGGTAACTGCACGGTGCGGGCTTCGGCTACGAGAGGGCACGGCGGATGAGTGGCGTATCATTAGTGGTCTCG
CGGAGGAAGGCATCGTCAGTAGGCGTTTACCCGACTTTTTAAAAAGCGTTCTCGACTCCAAGGGGCGACTCCGTCTTTACCTCACCATACAAGCCCAGGT
GGAAGGGGAACTGGTTTTGCAGTTGCACAGTGGCACGACTATACGCGTTTGTCGCCAAAGTACGAGCGCCATCAAGGAGGACATTCTCCTTGCAGCTGAA
CAGTCGAAGGTGAATCAAGACGAGCTGCGAAGCCTGCTCAACGTTGCGAAGACAATTTGTTACGACGCTGTTCAGCGTCGGATTCATATCGTTTTTTTGA
TCGCCAGACAGCGAGTCGTTACGAAATGGCGACTATACCGTATCGAGGGGCGCTTTACAGGGTGTCTAACATGCATCCGCCGGTCAAAGGGTCTGTCTGG
GCACGGCAGCTTGATACCGGAGGCGTCCGACTGGCGGCTCAACGAGATTATGTTGTGGAGCTCCATAATATCACCCACTTCGGTCGCCTAACAGCTTACT
TTGAGGCCCACATTGCCACGGGAGTTGAGCTCGATAATATGGACTCATGCACGCCTAATTTCCAGACGTCTACTGTGTGGAAACTAACCGTTAAACTCGC
TGGATGTCCTGACTTTTTGTGTGGCATTGTCCGGCTCATATGGTACGGCAGCACTATAATATTGAAACATCCTGAGGTTGGGAATCGCCTTCAGTGTTTG
CACTGTGGAGACTTCGGGCATCCCATGGTGCGGTGTCGCTATGATGCAGATCAAATTCGAGGACCGGGCAGCCGGGTGGAAACGGAGCAAGAAGTGGCTG
GTCTCGAAGACTTGGCTGTACCATTCGGGAGCATGGCAGAGGTTAAACAAATGGCATCTCTCAGGCTCCAGCTCCAAGTTGAAAATGATATCAAGGCTAA
GGATATGGTGGCACCGTCCCATACTCCTGTAGGAGCAGCCGCCGTTGATCACGATACAGTGCTCCCAGTTGCGGCTACCCCGCCTATTAATGCGGGCAAT
CTGGTCGCATCGGCACCCAAAAAGCAATGGGTGACGGTACCAATTCGACGAGGCAGAGCGAGTCGTCCTCGCCCCCAGCACCACCCTCGGCGGGCACCAA
TTACGTCGACTCGCTTTGCCGACTTGGCCGAGCAGTCTGACGATGAAGACGACGAAGTGTCTTTCGTGGAAGCAGTGCCCATTATCGACAGGAGAAATGA
AGTGGCTTCGGAGGAGGAACAGGCGGATTCGCCACCTATCGCGATCACGGATACGGCCAAGGCGAACTTGCGACTTTTAACGGCCAAACCGAAGAAACTA
CGTTCCATACCACAGCTGGTCAGTCTGAAGCAACGTGAACGGACTGTGTTAGGTGCAACACAAACAGACCGTTTGCTCTGTCGTGGCCCACTGATTCCAC
TACCTGAGGCCTGTTTAGCACCCGATCCTAATTTGGCCACGGTCGAAGCGGCTTTAG