Description :
From Genome Similarity Track
Location :
Scaffold_66:60628- 63705
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_66-fgenesh-gene-0.16Peptidase
Pytap_DAOMBR444maker-pag1_scaffold_66-snap-gene-0.49HSF-type DNA-binding protein

Sequence
3077 bases(100 bases per row)
CCTCAGACAAGTGGCTGGTATCCACTACGACGGCGACGCTCAAGAAACGACACTACTCCAGCGCCCACGAGAGTACCACAGAGCACACCACCGCCGATCT
GAACGACAGAAAGAACCCACGAGGAGACACCGATGTCGTTCGGTTTGCCGGTTGGAAGTGCAGAGGACGAAGACGCAGTCTTCGACTTCCACCCAGCGTC
CATGTGCTCAAGAACGATGTCTCGtGGCGAGAACGACTTGCCTGGCCACTTAGAGAACTCACTCATTTCCAGCCACCACTTTGGGTAGCCAGGTGTCTCC
ATCTGCTTTGGTGCCTCACCAGTGGTGATGTACCCATCACTGAACTTGGCCACCAAGCGCCATGCGAACTGCCACCAGCGAGCAACGACACTGGACGCGA
AGCCGTTGCTTTGAGTCTCAATGTACTCGTCGATTTCTTTCGTGGAATTGAGGGAGCGAACATGAGCCTCGATTCGCTTTCGCAGCGCAAACGCCTCCAT
TTGCATGGCATCCACTTTGGCATGAACGTCTTTGCTTATCGCATCGAAGCGAAGCATACTCCAGTTCTTCACAAACTCGAATGCCCACCAAGCGGACTCC
AGCGAAAACTCGCTTTGCTTCCCCAGCAGGTATGAtgCTGGAACTTCCTTCTGACTGCACGAGAATGGCACGTAGACGGAGCCATGTGGAGTGCTCTGAG
CATACCACATAACACCACCAACATTGTCGTGAAGATGAGAACGCGCTTGCAACaCGAAACTGTAAATGGTGCGGAACATCGAAATTGGACGCTCCCATCC
TCCGAGCACACCCTTGTTGTCTCCATCCCAACGCATTGGGTTACCGAACGGTCCGGCGGCAATTCCTTTtGTCATGTCGTACGGaGTACCTTGGTAATAG
TCcCGAAGTAAATTCATGATCGTATCAAGACCAACTGGAGAGTCTGGTTTCACTGAGAACGGATACGTCGCATATTCCGTCAcGGTTCCCAGTGTCGAGT
CCAGCTGAAGAGATGAGGCCACCACGTCCAGTACACGCCAGACACGACGGCCcACATAAAGAGGTCGCACTGGGCTAGTGTCCTGGAAGCCATATACGGC
TGTGAAGTCAAATGGCCCCATCTCCGGTGTCCACCACCCCATCTCTTCCGCGAAGCTCTTGACATTAGGCGAAGCAAGGTAGTAGTCTGAGTTGTTCAAA
TCGAGCTCACGAATCGTGAAGCCATTTGCAATCACAGTGACATGGTCgTCTTGTAGTCGCTGGGCTGCCCAAACCGCACTAGCATTGTCTTTGCCAGTAA
GCACATGGAATACCCACACTTCACCATACTTATCAGCAATGCCAAGTGCCTCaGCAGAGCTGGAGTATCCGGGAGCAGCTGGATCTCCACTATCTTCACT
GTAGAAACCGTACTCAACCGCTAGATCCCCCATCGTCTTCACAGCACAACGTGCCGAATCACAACGTTCCAGAGCCACTTTCGTGAGCTCAGCGATACCA
AACAGATTCTTCCCATGAGGTCCCGCGTCTGTGGGCCATCCAGCTGTTCTAGCACCACAAGTGCTTTCACCGATGCTCAACTGGACTTCGTTCATCATGC
CGTAGTCTTGGTCAAAGTACGCGTAAGTATGCTCGACTTGAGGTATATATCCGAGGGGCTTCATGGGCACCTCACTCTCGTCCTTGGGCTTGTATCCAGG
GCCtCGCTCGTCAGTCACTACACGTGGATATCCGCCAAAGAAGTTGTACACTGCGCGTTGTGCACCCGCCTTcTGCTTCTGTCCCGGCACGTAGACCAAG
CGAAGGTCAGCAGCACCACcACCAGCGTCGTCTGTGTGGGCGATGAGTGTGGAGCCATCCACAGTGGCGTTACGACCGGCAGCGATCATCGTGCACGCCT
GCACCTCGTGAGGGAGCCAAAGGCTCGCGGCCAAAGCCACCACCAACACTGGGACCTTGAACGACATTGCGTGAGTGAGTGCGTGGCTCGTCGACGAAGA
GCGCTGTCGACGAGGAGAGCGGGAGCCCGCGGGATCAGGTGgCTGGTGGCGCGCGGATTCGATGCGCCGTGTCGCCGTTGAAGATGCGCTCCTGGCAGAT
ATGCTCCGACTAAGTGCGAGTTCGATAAAGTGCGAGGGATGAGGGACACTGTCCCGTGTACAGGGACtacTACATAGTGAGTTTGTATGCGGGCTAGATC
AAAGACTGTCCCGAATTAGAAGGCTGAGACAGTGACTGTCGCAAGGGCCTTCCGCGTCAACATaCAAGGAATATGTATGTGGAGCGCAGTTTGAGGAGAG
GGAATCACAATGTGTGCATTTGGTAAATCATAAATAAATACGACATTGACTACAGTACAGAATGCTTCACGACAACCAGCATGGGCGCGTGGCGACGTTT
GAGAGGAGAGCGCCcGACGCAGATAGCTCACGAAGGGATGGCAACTTGCATCCTGAAGGAATCTTGCGAATTGCCGAAATAACTGGAATGGGACTTTCAG
TTGACGGCATGCTCACAGTTTGAGGGAGGACGAATGGGTTCATGATGCTTGGAGCGGCCCAAATCTTCGTGATTGGGGAAATGTTGCCAGGAGCAACGAG
CTGTGGCACTTCGACTGGACTCTGGAACGCCTGAGTGGGAAGAGCGACCGGTGTGGCATCCGGTCGAGGCAGGATTGGCTTGCAACGGTCACCGTTCATC
CAGAGAGGAGCAACAGCTTGGCGCTTCGAGTCCTCTTCATCCGTGGAGTCCGAAGCCTTGCGCTTGCGCGACTTCTTGCTTTGACGCTTGACAAGAGACA
TGGCACTGTAGTTGTCACGTGTGAAGTGCTCACGGCTGTAAGTAGGGTGCTCAGCACGAGCCTTGCTCCACTTGCGGAAaCCAAAGTAGTTCAGCTGACG
CTGGAAACTGGCGAAGTTCTTGTTCTTGAAGTACTTTGGAAGGATCTGGTTCGTGAGGGCTTCCTTGTCTAGAATCTGGAaGGCGATACCATCTTCAGTC
CAGCGAATGATcTtCTGACTTTCACGACGCAGCATTtGGTGGAGGTGAAGCAGGAATGGTGCAATCCATCCACGCTT