Description :
From Genome Similarity Track
Location :
Scaffold_28:606067- 607431
Sequence
1364 bases(100 bases per row)
CTTGCGATCTTGAAGGAAAGCTAGCAGCTTTACCTCAGCTTGTGTCCCAAAGGCCAGCACTTCATCGCGATACGTTGATGATTTTCGTTCAGCTTGAAAC
CTTCGGAGAGGAACAGCTTCATAAACGTCACGATCATCTTAAAGGTAGACCTTGCTGGCTTCGTAGCCGCTTCTGTCGAGCGCCACATTCGAGGTTCTTG
CGCGTACCAGGAGTACCATGCGTCTTTTAAGATCGTAGCCGCAGAGGTACGTATTCGCTTTACTGTCTGCGTGTTGCTGACCGCACCCTCACTTGTGGTG
TCTCCTGATTCTGTTCGTTCGCGCTTGTTGTAGATTTTAGACTCCATGGTAGACAGTCGGGCGTCAAGCGTTTGGTTGACTTGGATTAACTGCTCAATCA
AAGCCGCTTGCTGACGAAATACTGGGTGGTTCGTTATATCTTCCGAAGGAATTGGAGGGGTTATCATGTTGGGTTTCGCATCCGGACTTGTGCTGCTGGA
CAGGTGAGACGCCCGTGCAAGAAGCTCATTCACGGATGCCTCTTTCGCGACTACACATGCCTCGATACGCTGGACCGCTAGGGCGTCCGACTTCACGCCT
TTCAAGTATGAATAGTAGCGCAACACGTATGCCATGAGGGTGTCAGCGACGCGTGCGTTTATGTTGTAAGCCTCCACATCCAGTCCAGTCGAGGCACCAA
ACAGCGCAGAGGCGACAGCGCGGATTCTTGATTGCGTCTCAGAGTCGAAGAAGTCCAAGGCTAGTAGTGGTACCGGTTTCGCAGAGTCGTGGCCACTCAG
TACTCGGGCAACTTTGTGATCTTCGGCTGGAGTATTAAAGTAGTATGCGAAGGCCTTGTTGGCCGACGTCATATTCCACGCACCTCTATCGGAGATCCAT
TGGACGCACATACCTGACCCATTCGCGCGCTGCGCTCCTCCTCGTCGAAAGGAATGCAATCTCCGGTTATCACCCACATCTGCCCTACCCATGACTCGCT
CGAGAACGCGATTCAAGTAGCTGTGGATACCGGGCGAGGCGTCCACCGTTTTCGGCTGTCCATCAGACTTTGGTGCGTCTTGAGCATGGTCGATCAAGTC
AATCAGAGGAGCAGTTAACGTCTGAGATGGTAGGAAAGGTCCTTGCTGTTCTGGAAGCTGGTTGAGAAGTGCCGTTGTTGGTGATGAGCGCGTGATTAGC
GCAAGGGCAACGGCAAGCAACGGACACGTGGTAAAGTCGGATTCTGAGAAGAGCGATAAGCCTTGCTTCTCGAATTTCTTGACCCGGATGAACCGACCGA
AAAAGATATCGCCGGATCCAATCGTCAGATTCGTTTTGCGGAGAAGCGTCAGGTCCGACGCGCG