Description :
From Genome Similarity Track
Location :
Scaffold_6:60601- 73143
Transcript NameFunction/comments
Phyta_totarag446hypothetical protein
Phyta_totarag447hypothetical protein PHYSODRAFT_476538
Phyta_totarag448hypothetical protein PHYSODRAFT_552380
Phyta_totarag449hypothetical protein PHYSODRAFT_284317
Phyta_totarag450conserved hypothetical protein
Phyta_totarag451hypothetical protein PHYSODRAFT_475220

Sequence
12542 bases(100 bases per row)
CGGAGGCATTCTTGCATCGTTCTCCGTCGCTTTGTGCAGCATGTTCGAGCGCCTCCCACCCGACTCAATCCCTGAGGCACAGCTTCGCGAGGTCATGGAT
GCCACAGTTGCCATCCTTGACCATCCCTTCGCTCTCGGAGACTTGACTCGAGCGCGCAACGCTGTGGGCTTTGTGTTGCGCTATGGACTTAGTGGATGTC
TAACAGAGCGCCAGCAAGaggtgctgcttggcgcATATCTACAAAGACTAAAAGATGAGGCTCAGGCATCTGAGCCAAACCACCACAAGATATTGTCGGC
CTTAGTGGAGATGAGTCATATGTTCCACTCAATGGGCGAGGCTTCTGTTACTCATGCGcgcgacgccagcgacgtACTCCAAGGTCTCATTTGCCACGAA
AAGCAAAGTGTTCGCTTTCAAGCCGCTGTCGCGCTGGCTTCTCTCGTCACTGCAATTCCGTACCGACTCAAAAGCGTGCTGACAAGTTGTCTTCACGGAC
TTCGGGATACTGCCGAGTACCTGATGCGCGGCGGCTCAGATGTCGAAGACGCGAGAAATTCAGAGTCAGCTGAGAAGGCAGAAGATggtcaagatgaagg
aaaCGAAATGCAAAGCAAGACCCACTTGTATGCGATTCAAGGCAGATCCGCAGCAATTGCCCATATTCTTCGCGCCATCAAGATTGACGCCAAAGGAGGG
TTATCTCAAACGATTATGGACGATATCTATGCCATTTCCGAGGAACTTGTCGAGAGTCAGTTTCTTAATGAATGTGCGGATAGTATCTGGCTCACCTGCA
CGCGCGCTGGTTGGACGCTGGTGGGAAGTCTTGTGTCCATGAACGACGAACAGTGGATTAAGGCCAATTTGGAGAAGCTCCTGAATCTATGGCTCAAGTC
CAGTGTGTTACACAGTCGCGAATCATCtctcgagctcctgcgcattgaagctgctgtaaTTGCTctgagcagcttcttgtccaaTTGCCAGGATCTTGAA
GTGGACTCTGATAATGATGTAAACCTCCTTGCGAGTCATGTCCTGCACGTGTACTTGACGGCAACACAGGACACACTCAGTAAACCTCTCAAGCGTCGCG
GCCAAATTGCTCGGTATCGTCTAATGGGGTGGATCATCAACTGTTATTCGATGCTCCCACAGATTTACAGTGATTCATACATCGTACTATTGGATTTGGT
AGCCGAGTTCACCACAGCTCAGGCATTGACAAACCTCCGACATTCCTCGCTAGTACCGGCGAAGTCTACGTACCTGCAAAGTGTTCTTTCTTCGGAGGAC
AATACGCTTGACATAGTAACCCTCTCGCGGTTGGAACCAGGGGATTATCCATCCCCTCTGTACTCAAGGGAGCTGAATCACGTGCTTGGTTTGCAGCAAC
GGGAAAGCGCTTTAACGGATACCGAACTCGAGGTACAATATCTCGACACATTTTGGAGGTCGATTGCTGAAAAAGAGGCTGTGGATGGTGGTACGAAACG
AGTACGCTGCAGCCCGTTTACTTACGTTCGACTCGTGGACGCAAGTGTGCTTCTGTTTGGTCGACTTTTCCACTTCGTTCCGGAAGATTTACAGCTGCGA
TGTCTCCAGCACTACGCAGGAGCCCTGACCGATGTCCGTGCTGATTGCGAAGTCAATGTGTGCTCGCTATTGTTTGCTGTGATTGCAGAAGCGAGACGTC
TCGAAAAATCCGGTGCCGCACCAACTTCATCAACGTCGCTTTCTGCAACATCGTGGCCTCTTCAAATGCAAACCATGCTGTGTGAAATGATTTCGAGTGA
ACAGGCGGAAGTTCGTCGCGGTGCAGGCGAGGCATTGGGAACGCTAGCTTTGCTTCTTGGGGAAGACCAGTGCAAGGGGCTGATTATCGAGTTGGAGAAA
CGCTTGGTGGTGGATAAGCTCCCACAGGGAGCTTCTAACGCTACATTCGGCTCCAACGTTGACCTGGACGTGTCTATTCTGTCAGCTGGCGCAGCGTTTT
CGTTAGCTTGCATTAAGCGCGTTTGTGGCTCCCGCATCTCCATTGACACAGGCCTCATTTTCCGGTTTGCAGGTGAATGTTCTCAACCTCTGCGTACGTG
GATCTTACATTCGTGGGGCATTATCTTAGAATCCGTCAACTCCACAGGAGGTGACTACGAGCAGTTTGTAAGCTCGACATTTTCTCTCATTGAAGCCCAT
GCACTGGCAGGTTTTGTCTATTCAAAGGTCAACAAACGGGGTCTAAGATGGCAAATTAGCACAAAAGTAGCGCTGGGACGGATTATTAATGACGTGGTGG
CGACGCTCGGTCCAGAGCTTGGTGGTTCAAGTGATCGTTTGAACCAATTCTACTCGTTCTGGAtgcttcttcgccaggaTGGTGACGCTCGTGTCGAGTT
GGAGTTTTTGCGGTTCCTAGAGCAAGTGGTTGTGTTCGCGCCGTCTCGCTTTCAATCTGCAGATTTGAGATATATTTTGCGCATCATATCTGATACTGCT
TTATTAACCTCGGCAACTGCATCGTCACTAACGACGCAACAGAACTCGGGGTATCCAATTTTGTCGCCACCATCAGGTCCTGCCCCATCCCTGGCTACTT
TCGGAGCATTTGGGGAGCCATTTGAGCAAAACGGTCTCGTGAACGTTGGTGTCTTTACAAATGGCTGGAGTCGGAGTATCCTGCAAAATGTCGGTTTGTC
GTGCATCCGTACACTGGTGGAAAGGGACCCGACATTAATTCGCCGCCAGAACCTGTTTTGTCTTCTCTTTTCGGCTCTTCACGTTGAGTACAACGAGCTT
CTGTGGGGTTACTTGCCTGGGCTACACGGCATGTGGGACGTGCTCTCCTTCGCTTTTGCTGATTCTACAACCATGCAACGGAACGGTATTAGTGTGCTGC
AGAGCACAGCACTGGCGCTACTTGACGTTGAAGGCAGAGACCACGAAGGCGCCGAACCGTGCCTGTGGGCTCTTTTGTGCCGTAGTATTGCCATTGGCGA
ATCAGCAAGTGCATTTGCTAGTGCTAGTGCAGAGCAGCTCATGATGAGCCCAAAAGGAATGAACCCCGGTATTCAGACAACAGCCAGCATCGAAATTTCA
GGGGATGACGACACATCGGCGTGGTCACCAAACCCAGTTTTGGATATACCCAAGACTGATGCAAACTCCCTTGCATCTGCGACTGTTGCTGCCCAAGTGG
ATACGTGGCGAGCTACAAAGGCAAGCGTGGGCGACCTCATTGCGTTGATGCCACCGCTTTCACGCCAAGTACGCCACTTCGCGGCGGAGTGCGTGTTACG
TGTGTTTGAACTTATGGCGGCAATCCCACCTATGACGATTGGTGTGTGTCAAAATAAGCAACTCCATTTTGATCTCGTTGCGGCACGCCGCTATTTCTTT
GAGGTGCTATCTGCTGAGGCTGCGTTGCCAGTTTCCGCCGAGTCGAACATTGGAAATTTTTTGTGTATGTATTTGGACGAGTTTGTCACTCTCGCATGCC
ACGTCACTACGACTTcagcagaaggagacgaGTTGCTTATGTTCCAATGTGTGGGGCTTCGCCTGttgaacgtgctggtgaaaAACTTTGCGTCTGCTCG
TGATCCGGAAGTGGCAACGGGGGATGCTTACTTGTTAGATCCGTACCGTGCCCAGCTTTCGTCTGCTATTCGCCATGCTCTCAAGCAAGTACAAGTGGAG
TCTTCATTGTTGACCTCCAGTATAGAAAGTGAAAAAAGTGAGGAAAGCTACTTCTACGCACCACTACTTCTCGAAGCTCATGGGATCGCAGGTGCATGTG
TTTCAGCTCATCTCATTCAAGATAAGGTGGGATTGGGACGCATCCTGAGAGCAGTTGTGACTCAAGATTATGGCCACGCGCATTTCATTGGAGATGAACT
CACCCGCGCTTCTCTTTCGCTCGCTAACTTGGCATCTGTCGGAGAACTCCTGACGTCAAGTGTCACGGAAGCAATTGCTCGAAAAGATGCGCGCGATGAC
GAACGCACAGCTATCGCTACGTCTCCACTTGTGAAAGCAATGACTAACGGTTTGTCTGGAACCACCGAGTACTTGTTCAAGTGCTGGGTGGATACTACAT
TTGGGTACGGCGTTGTAATGCAAGGGTGTGCACAGTGGGCGCAATTGGACACAACTTCAATTGCAGCGTTACTGACTGACGAGTTAATGGCTATGCCAGC
TCTTCAAATGCCGCTCCCACCgatcggtgctgctgcgaacgctccagcaactgcttTGTCGATCTCCAAAGAACTGCGCGCGCTTTACAAACGGTACTGG
CCAAAGATCGTCAATGCAATGACAGTATTGGAAGTCTACATGCCAAAGTCGGTTTCTTTGTGCAGCACTCCGGGAGGCAACATTCCTAGATGGTCGTtag
tgctgctgtccagcGCGATCTTTCACGTAAACGCAAACGCTCGCGACCGAATGGAGGATGAAGGGGAGCTGCCTGGTGTTCTTCGTAGCATTCCGTTGCT
ACTGAGAACTTTAGTGAATAACTCACTCAAACAAGGtggctcgtcgtccagtAATTTTCCAGTGCTCTTGACAACAGCACTGGATACACTCGTGCTTGCA
AGTAAGAGATGTTCTGGACCAGCTCAAATTGAGGCTTTGAACGCATTGTTCTCGTGTTTATCGCGCGAAAATCTAGCGTTTGCTAGAGAAATGTGTCGCT
CTGGAGAGGATGAACAACAGCGCTGTGCTACACTGTTCGACACCGTGGCGCGGGCTGGGCTGTGCCCAACAGAAGTCGTTTGTCAACTTTGCGACGCAAC
AGAGCAGACTCGACATGCTCGGGCAGTAAGCATTAGTAGCAGAACAACGGGCCCCCGTCGTAGTTCCATTGcaagtgacgaagatgccaaGCACATGACT
GAAATCGTGCAGTTTGCTACAACTGGTATTGTGCTTCTGCACAcgactgaagaagcgcgaaGTGGGGTGGTGCGCACGGTGGCCCTGGTTCAGCTGGCCA
TTTGCTCTGTTGCTAGTGGCTACCATTCTTCCTCGGTAAAGGAAGCTGCGGTGGCGCTTAATCGTGCGTCTACCGAGTCGGTGCTTGCGCTGGCACGCGC
GCTTGAAGCGAATAACGATTCGGATGATGACGTTTTAGACCGCATCAACTCAAGTGTACACAGTTGTTTCGAGTTCCTATCCGAGTGGCTTAAGGTAGAT
ATTCACACTACTCCAGGTTTTTCGATGCAGATCGTGGCAAATTATGCTGTGAGTTTCCCGGCCTGccttgaagacgacgcggAACGATTCCATGCTGAGG
TTGCAGAAACTACTTTGGCGATGTTGGAGCTTACACCTGGAcatgaaggcgacgatgttaagaagcagcaacatgcaGTTGCTAGTGCAGAGCTTCTGCG
AGGTTTGCATGCAGTTGTGAAAAAGCTCATCGACGTGCATCAAACCCCCATTTTAAATCGGTATCTGGTGGCACTCGGTCCTTGTCTCGTCGAAATTGTG
GGAGTAACCAACGGCTTCCCAGAGAcagctgcagagctcgcGGAACTTGATGAAGCGGAgggtcttcttcgtgtgtTGACGACGCAGTTGAATGACCAAC
ATGGCTCCGCGTTTGTACACATGCTGCTCCCGAGACTTGCGGCAGTGCTCAGCCATCCTACGCCGTCAGCTGCAGACAATTCAATTCCTGCGCAAGTCCC
CGGCATCCTGGCGCGACTGCTTCTGTGCTTTGCACAGACCCACGCTACTGCGTTCAAGGATGCAGTGGCGGCCATGGCCCCAACGTTGTGTGGTGTGCTG
CAGACTGCGCTGCGCCTTGCTCTCACCGGCTCGAATCCTGGAACACGCGCACAGGCGTCACTTCCGCAGGCCAGTGGCCCTGCCGCTATCAAGCTTGACT
TAAGTCGATACGCCTAAGCTGTAGACCCCGTGCTGCTAGAATGTTCGAGTGTGAATGAATTACATATATTCGTACGTAGTTGCAATGCGCGTTAAGGAGC
ATCTCACGCTGCTCGGGTGTCCATGTACGTGGAGTATTTCCAAGTCTCGATGTTTGATCGGTGGTTGTCAACCCGCCCCCATTTTATGACTGCGATATTA
CTCAGAGCGTCGTCTCCGGGCGCGAAGTCGTGACAACATCCTGGACTGCCAGTAGCTCCAGCAGGCTGAACAATACTGTGTGTACAAGGCCCATGCTGTA
AAACTGACGAAGGAAACAGCGGTGTAAAAGAACACGTTAGACATCACAATCTAGCCAGCAAATGAGTCGGCTCGACAAAACTCACCTCCACTCCTCCGTC
CAGGTCAACGGCTACTTCCTGCATCTCAATCCGTTCGATCTTGTAAGTGGACAGGTCAAATGGCAACGAATCAACGTACAGACGCTCTGTCAACTCGATG
AGCTCTGAATACAACCAACCAACCCAACCCAAGCACAACAAGACACGTCAGCAATAGTACATCATCACAAAGCAGTCGTCAATCTCTCTGAGATCGTCGC
GTACCTGGTACGTACGCGGACGGGCGGTTGCCTCCAGGTCCGTCTTTCGTCTGCTGAAAGAGTCGACGCAGCGTGGCCCAGGGCACCGTAAGTGTGTAAG
TGCGCACGACGTCCTCTTCTTTCGTGGCACGGTACTTCAGCAGTAGCGGTGCTCGCGGCGGTTCTTGCGCGGCCATGGAGCTGCCGCGCGAATGCTCtcc
ctcttcttcttcctgatTATTCCCATCACGTTGAGCTCTTGGCAGTCTCGCTCCTTCAGCCAACAGACTCGCCACCGCCCAGTTGCGTGCCAAGCGCTTA
AGGTTCATCTGCTGGATGTGCACTACGTGTGTGCTCACCACGCACTGGAAgcggtgctgcagccacgagcACACCCAACGCAGCAGGACTTCGTCTCCTC
TCAATAGCAACACCTGCTGTCTCTCGCGTCCTTTACGAggcgctcgctgctcttcttcggtcGGGAAGTAGAGTACGAAGCCCCCAGAGCGTTCCGGTGC
CTCTCTCTCAGGTGCAGAGGCTCCTGTCTTGGCTGCTCTGCTGCGACGGCGGTCGCGCTCCTCTCGGATTTGGAAGGCCACGAACGTGTCTGTATTGCGG
ATGCTCACACTGTAGCCGAACTGCTGGCCGCACGCCCGCAGGGCCGCCGCACGCAGAGTCTTGACCAGATCATGCGCGTACTCACTGAGCTGCTCGCGGT
GGAAGTGGAACAACGGCGACGCGCAGTGGAAGATCCAGCGGcggtccagcagcacctgctccatgCTCacgcgctcgcgctcgcgaCGGGCAGCGGCTTG
GCGCGGCGTCTCATTCTCGCTTTTGTCTTTGtccgcagctgctcgctcaCTGTCCGCGTTATCCTCGGGCCCGCGTGTGTACTGCGTCGGGCGCATGGGT
GAGTTGTAGGCCTctcgcagcttctgctgctgctcgggcGTGATCCTGACGGAGGGCTCCTGCGGACGCGAGCTCTCCATGGGCGACTCCACTTCTTGGC
TGCAACTACTGGGACAACAAATTGTCATCATGTCGTAACGGTTTTTGTTTCTGTGTGCAAAGGCGGACCAAAATTCGATAAGGGTGAAATTTTTTGATAG
TGGACGGCGATGGCCGAAAGCTGTCAATGGACCTCTTGGTCTGCATGGCCACTTTAGCTCCCTGAATGACTGGACTACAACATATACGCAGCCTATCCGC
CGGCcaagagcaggaagatgAGGATCACCACGAGCACCAGGATGATGATGTACAgcttggtgttgttgctttgCTTGGCCACCTGGCGTGGCATGAGAGG
AGAGCGTTAGCACCGCGTCACTTCGAGGAGAGAATATAAAAGACCAACATACCCGTGCTGCGCGCGCGCCCTCGGACTCGAGTCCGTCCGTGACGCGGGA
cacatcgtcgtcgatctcgtccagaaGCCGCACgtgcagctccgtctcgtcCTTGACGGTCAGACTGTAGTTGCGCAGGTTGGACACGCCCTGGCCGATC
AAGTCCAGCTGCTGGTCCTGGTCCTTCATAATCTGGTTCTGCATGCCCAGCAGCCGCGCCGGCGCATCGGCCGCCCCCGGACTAAAAGAAAGCACGTCGG
TCTCCATGTACAGCTCCATATCAACCCATTTGAGGCGCGACGCACCTCACTGCAGCCCGCGACGTCTTCCGGCCGTTATACATATCCAAGTCCTCTTGCT
GCAGGCCATAGACATCCACACAGTCAGATCCACAGCCATCTTTTGACTCGTTAGGGTCATCTGTTTACCTGATCGTGTGCTAactggttcagcagcagct
cacgccgctcgatctcctgcGCTGTCCTGCATATCAGCAATACAATGCATTTCCCGCCAGTGAGCCTCATGAAATCCCGCGGCCAACGACAATCGACGCC
CGtacacggagctggacgagcgctTTAGCTGGTCGAAGTCGCGTTTGAGCCGCGAGacgctctgctgcagcgcgaagacgctggtgccGATGGCGCCCGA
GTTCCCCGTGCGGATCTTGCTGGACAGCACCTGCTCCTGGCCGCGCGCGCTCTCCAGCCGGTCCagccacgacgcccaagCCGTCGCGctcatcgtcgct
gccttAAGTTGCTCggtgagagagagagatgaAATCTTTCTGATTATTGATACCGGTGTTGTACCGATAATACCGGTTGTAGACGGTAGTGCTGTCAGCG
CCCACCCATTATTCAACAGCGCGAGCAAGACACTTCGCGGAGACCATGAGCCAGCGGGAGTTCGAGcgcaagatggaggagcacATCGAGGAGATGCGCG
TGACGCAGACCATCGCGTACTTCAGCCGCACGGTGGAGCTGTGCTTCTCGGACTGCGTGCACGCCTTccgcagcaagaagctggacgacaaggagaCGTC
GTGCGTCAACAACTGCGCCGAAAAGTTCCTGCGCCACACGATGCGCTCGTCCGTGCGTCTGCAGGAGAGCTACGCCGAaatcatgcagcagcaggagcag
caacagaaatAGAGAGACGACAACGGCAATGGCAAAGACATTGGACCGTAGACAGCGAGCGAGTGACTGAGAGAGCGAGAGAGGGGGACATTGATACAGT
TATGAACATCTAAACAAGACTCTCGCAAGTTGCGAGTCGCAATGGCGCTACACGCCCGGTTTTGTATTGATCGTCGGCCTCGTACGCAGCAGTTAACATG
CAGGTGCTGAGCGCGGGTCACAGATCCACGAATCAATACCGATTGTTACCGGTAAACCGGTTTCAGACCCAATTCGTTTGAATTCCCCATTTCGGCGGTT
CCCTCCCAAAAAAATGGCGTCATCTCCCACATCTGGTCGCCCTGGTGGTTCCTCTGAGGACGGCGAGCCGACTCCGACGCGCGGGTTCTCGAAGCGCGGC
GATGGATTCTCCGTGCAGGAGACGGAGggtctgctgcaggaggtgcGCGAGCGCTGGCAGGAAGGCTGGGATGTGATCGCAGACGTGCACAACGCGCAGT
TCCCTGGCCACAAGCGCACGTCCGGCtcgctcaagcgcaagttcGCCAAGCTCTACCGCACCAAGATCGACTCGACCACCAAGGAAAAGCACGCGCGGGT
GGCGGCCATGGCCAAGAGAGTGCGCGAGGAGATGCGCGGCCAGCGACGAGGCCTCGCGAGCACCCGCGTGCTCAGTGAGGACCTCGTAACGGAGACTGAG
GGCAGCGTGGGCGTGCAGGAGGTCCACGAGGACCTGACCGAGGTGGAGATGATCCCTTCCCAGCCCCAACCTCTGCCGGAGGCTACAGTGACGGCCAGtg
agcacgagctgcggcAGACGCTGAGTCAGAGCGTCCAAGAGACGCCGATGAGAGATGCGTGGCAGACCATCAGTCGGTGGCCTATTGCCGGTGAGCGGCT
GCGTATGCTGCGGTCACAGATTGAGAGCAACGAGCCGACGTCGAGTCAGGACTTGGTGCAGACGGTGCTGGTAGTGTTGCTGGAGTCGCAGCGCCAACGG
GACTTGGAGCGTGAGCAGGAACGCGAGGAACGTCGacaggagaagcagcgctggcagGAAGACATGCGCGAGCAGCGTCGTCTACATGAGCAGGAGCGTG
CCGAGGACCAACGCAGGAATGAACAGTTCATGCAGGTGATGACGACGCTCGTGGCTCAGATTGCAGCTGGCCAGCAACCGCGAAGCGGCTTGAATTGAGC
GTCGTGGCGAGCAGAAGGACCCGCACGCAGGTCGTAGCAGTATGGAGTTGCAGGGCAAAGCGAGGGACGGGCGTATGTGTTGCACAACATTGATAATAAT
AGTGGATGAGCAATTATGAGGCCTTCGTCCAACGGGTCGTTGGTATCATAGCAAAGTCTGTGGAACCGTTGGTTCCAACGTGACTGGTCCAGGTAGGCAA
GTAGTgaacgaagaagctcaacaaCATTGGCCTATTCCTTGCCACGCATCCATAGTAGAAGTAGCTCACAAGcgtattatacatgtaacCTCCATGATGT
AGGCACATACTTACGGTAGCTTGGAGTGCTGGGCTTTCGCTCCATTATTTCTCGGATTTTTTTATTCTCCTGCATGATCTCTTTTCAGCATGCAGGAGAA
CGGAGGCCACCCCATCATCTACGACCTGGATTCCGTACATGGCGCTGCTTTTGTCCAGGACGCGGTCACTTTTGGTCATCAAACCAACGGTGCAGCTTCG
TTCATGCCGACCTAGTGTTTGAAATGGGGCGCATTACTGGTCGCGACACCTTGGTAGCGGTGCTCGATCAAGATGGCATTACCATCTCCGACTTCGATTA
GCTGAGCTACCTAAGCTTAGTAACATTGCGATCGAGGCTGGCATGCTGGCCGCGATGGAAACCTACAGCTCCATCAACGGTGTACCCGTCATTCAGAGTT
CTAAAATTTTGGCTTCACAATGATTTGAcctccagcgacttcaaTGAGATTAACGCCTTGACGAACACTGTTCGCAGCACCAATGAAGCCTCCCAAATGT
CGCTGACCCGTACGTCGATCGACATGAGCACGGTAGGCGCTTGCTCCAGTTTCTTCAACAGAACTAATAACCTAATCGAGCAAAGGCCGCAATACAACGA
CACCGCAGTCGCCAACCTGCGCCACCTTCACACTGCAAACGGGCGAGTACTGTATCAATTCAGTAGTCTGAAATTTGAGTAAACGAAGGCAAAGTTGGAG
AGTACGGAGTGCGTAGAGCTATCCTCATTGATAATTGTTCTGAGCTCGATGCAATGGCGAGAGCGTTGTGCAGTTCAATTCGCAGACACCTTGCCTACCT
ATTGAAAACGACGCACGGCAgactgcttcagcgtctcaGCTCTTGCTGCCCTATGTAAAAGGAGACAACGCAGTACCACAACGCACATCAGAAGGTACGT
CCAGCGTTCGATTAACACTCCGTGTCTCGCTGCTGGGCGGTGCCATTCTTGCCCACGagcagcatcatcatctgCATGAACTGCTCGTGTCTGCGGCGGT
TCTCGGCACGCTCTTCGGCGTGTTCTTCATtacgacgacgtcgctcttCGCGCTCTTCATCACGTCGatggtcttcttcctgtctCCGCTGTTCGGCCTC
TTCCCTACGCCGTTGCCGCTCCTCGTCCCGACGAGtgcgctcttcttctctgtcCAGGTCGCGTTGGTACTGCGAGCGGAGAACGACTTTCAGCACCGAC
GTGAGCAAGTCGTCGGTCGGCAACGGAGTCGCCTCCGGTGGGAAGACAGCTGTCGGGTTTTGCCACTCGGGCGTCTGGCGTGGCACTCGCGCGCGCGGAC
GCGgggcagcagctggagcaggagacggcgctgcaactggacctggtgctgctgtcgtgaGAGCGGTGGTAGTCGCAAGAGGAGGCACCTCCGACGCCGT
GTCCACCCAGCTGTGCTCCGACTCGGTGGCTCCGTCCTGTGCTCGCTCGTCGCCCTGTGGCGGCTGGAACGAGGTATGCTCCgtctgctcgtcgtcgact
cTTGGCACCGCGGCGCCAGGCGCCGGCGGGATCCCTTCGATCATCTCCTTGTGAACCACGTGGGCGAAGGTGATGGCCTGGTGGTTCTTGGCGCCGCGCA
CCGGGATGTTGGACCGATACAGGCGCGAGAATTTTTTCTTGAGCGAGTCGGCCGAGCGGTTGTGCTTGGAGAACTGCTGGTTGTGCATCTGCGCGACCAC
GTCCCAGCCTTCGCGCCAGTGGCTgcgcaccagctgcagcatgccTATGGACTCCGCCTCGGTGAAGCCGTCGCCGCGCCGCTGCACGTGCGGCCCGAGA
CGCCGCTTCACCTCCGTCTCCATTACATCCTGTGGGGAAAAGCGTGCAGCCatttttttgttttggtgAGGGGGAGAATTTGCGAATGAATGAGTGGATC
AAAAATTGAGTTGGATCTGCCGTCATCATTAACGCACATTTTACTGGATTGAAGTATATATTGACATATTCGACTAAGTACACATCGCTTTTCGGTGCGC
AAAAATGTCCAACACAGATTTGAATTTTAGACACCTTGAAGT