Description :
From Genome Similarity Track
Location :
Scaffold_567:606- 4301
Sequence
3695 bases(100 bases per row)
TTCACTCCTTCCTCATAATCCACCCTTCCCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCATATCAGCGATCCTCCTCCTCCTGGCCCA
CACCCTTCCTGTGGGCCCTTCTTCATCCTCCCATCGATATGACCGACTCACATCAAGGGATCCCCTCCCTACTCTTCTTCATGAGACTGCATCACGCCGA
ATCTGTTACGATTCGTACGATCCCGCAAGAAATCATAGAGTAATGCTCCGCAGTTCAGATCTGCCTCGTCTACCCAACTTGGTTCGTCATATCCGCGCCA
ATACACTAGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGTTTTCCTGACCTCATATCGGTGATCCTCTCGACTTCGAAATCGTCGTCTTCGAGATCC
ACATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAGTCGACGCGGTCGGATACATCCACTGAAAGACGGATCTGTGGCCGATCCGGATATTCTTTGA
CCAACTTCAGCTTGGATACGTTTACCACAGGGAACAGGCGGTATTCGGTACCTACCGTTTCCAGCTTTACCGCATGTTCTCCAATCTTCTCGCTCACCCG
GAACGGTCCATGTCATAGGTGGGCTAATTTGCGGGCATACCCCTCTTTCACTCGATCCAAATAAAGCCACACCTGTGATCCCACTTGGATTTGATGTGGA
CGGGCATCTTCGTTGTGTCGATCCGCTCGATCCTGTATCGCACTCCGCAGTCGTTCGTTCACCTGGGATCTAGCTTGCCGGTAATATTTCTGGACTTGGT
ATCGCCATCGTCTTAGATCTCGGTTCCTCTTCTTGGTGCTGCAAACTGGGATTGCCGCTTCCAGGGAGGATTTGGGATCCCACCCATGTACCAAGTAAAA
TGGGGTGTCACCCCGGATCCTGTCTTGGGCGGTGTTCATCGCGAAGGGAAGCCGCTCTGCGTACTCATCCCAATCCTTCTGATCCAAATCCTGGACATAC
ATCTTGAGTGCTCTCGTGATTGTCTGCACCATGCGCTCGGCCGATCCGTTAGCTTGGGGACGATATGCCATGGTTGCTCGCTGTCGCTGCCCCAGGATCC
GGTTGAATGCTCGAAAGAAATCGGACATAAAGCCTGGCTCCCGATCATGCCTAATCATCTCGCTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGA
TTCAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCTTTGGCTATCACGTATCCGGTAAACAGGTCCACCCAAATCAACAATTCTGTGTTTCCTTTGAAC
GACTTGGGCAACGAGGGGATATGATCCATGGCTATGATTTGGAAAGGGTAAGTCGCTTGGATATTCCCAGGTGACTCCCCTTCGATTGTGGGCCTGCCCT
TGCCTATCTCACAATCCACGCATTCACCGACGTATCGTTGTACGCTCTTGAATAGTCCTCTCCAGTGGAAACATTCCCGGATCCGTTGGTAGGTCCGACC
AATACCCTGATGTCCGCCTTCCAGGCTAGCATGGTAGTGGTGTAGGACATCCTGTTGCAAGGTTTCTGGCATCACCAGTCTCATCAAATCCATCCCGGTC
CTCGTTGACTCTCTTCGTAGGGGGGCAATAGAAGAGCAAGTCATTCAGATCCACTGCGTAATCCGTAGCGATAATACTGTAGGATTTGGTATCCTCCCGA
CTCAGGTCTCGTACATCCCCCATCAGATACTTCTTTAGTCCCAGGATCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCGCTCAATGCGGACTCTCTTCA
CAAATGTTTCCTCGAGAATTTGGGGGTTGGATCGAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTCCTTTTCCCGGATCCAACTACCAC
CACTTCGTCTAGTCGGTTCAACGTAACGGGATCCTGATGCTCGGCCTCTCTCTCCAATTCAACACCACATTGATTCCGTAAAGCGGCGCTGGCCAAGCTA
TCTGCACTGGCATTCCAATCTCGCTTGACATGCACCAACTCGTGATTCATCCAACCGCGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCG
AGGCCTTGCAGTCAATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAACCTTTTCGGATCTTGTCCCTTTAGTAAATCCAA
ACCCAGAAGGAGTCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCCGCGTAAGTGGATCTGGCCCGTACAACTTCCCATCCGGGCAGTCTCCACAGT
ATTGCACTGTATGCTCCCCCTCCGCGTCGTACACGAGCGGATCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCT
GGATCCGGCGTTTGGGCTCTTTCTTAGGAGCGACCTTAGTCAGCGCTTCATCCATCTTAGCTCGAGGTGTGATGCTCACGGCCAAGCCTCCCAGGATCTC
GTCTTCCCCTTTCGAACATTTCACAATCTCCAGTGTCCAAGGCGAGAGTAGAGCTGCCCACTGTCCCAAACGTCCTTGTAACCCGGCCGACTTGAACAGC
CAGGCTAGCGTAGAGTGTCGGGTCAGGATCCGGATGGATCTTCCCACCAGCAGGTTGTAATTCAGGTCCAACACGCGCAGGAACGCGAGTATCTCTTTCT
CCACTGCTCCGTAGTTCAGTTCATTCGGCTTCAGTGTCCGGCTGACGAAGGTGACTGGATGACAGATCCCCTCATGTTCTTGTACCAGAGCCGCTGAGAT
TGCCCAGTCACTGGCATAAACTATCACCGTAGGTTGACGTTCCGGATCGAAATGACGGAGGATAGGCGTGGTCGCGATCCTGTTCCTCAGTTCCACGAAT
GCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTTTTCCATGTTCCGATCCGTCGTTTCTATCCAGACTGGATCCTCTCTCCATTGGTCCCGGGGTAGAT
CCAGCTCCTGTTTTAAGTCCTCTTCTGTCGTCGTACCACTTGGATCCCTTCGTGGATCCGACATATCCCGGGCCAGAGCTTGTTGGATTTTTATCCGGAC
AGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAA
CTTCCCAAGAAAGATTGCATCGCCCGTAACGACTGTGGGAAGGACAAATCGGCTAATGAAGACAGGTCCTTAGGATTCGCCTCCAATCCCTCCTTGGAAA
ATCGATGGCCTAAGTACTCCACCTTACGCATCCCCCAATAGCTCTTTACCACACTGATAGAGAGATTCCACTTAGTACACGCCTCCAGTAGGGATGTCAA
TCTTTCGCACAACTGATCCCATGATTCCGCCGGGATCAGAATGTTGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCC
CCCGCTTCGAATGGATCAACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTCGGACTCCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGAC
GTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGATCC