Description :
From Genome Similarity Track
Location :
Scaffold_1603:606- 4231
Sequence
3625 bases(100 bases per row)
TCTCGGATGTGAGGCCAGTTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACCAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGC
CCAAGATAAACAAAAGGAGTACTCGGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGATTGGTGACTTAGTGTTACTAGACACGAGGAACCTACCT
CTAGACACTGTTAGCTCTGTCGGCAGCAACAAGCTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACCATCGACC
TTCCAAAGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAGGGGGTTGCTGACTCGCAGACCCCCCTTGACCC
AGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCCAAGCCTCGGTCGGGACGGCAAGGCTGCGGTCAAGACCGTACG
CCGGAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGAGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGG
CGGCTCCGGACGTGGCAACAAAGCCTCGATCCGTCGGATCATGCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGGTCCACCCGCAGGTGCAGG
CTCGCGACCTCTCGCTCCACCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTTCCGGCCTGGGCGGCAGCATTACCGCCAGTCCCAAGGC
CAAGTGCAATCTCAAGCACGAGGAGACGTTGACGGAGGCGGTCAACCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGAACGAGAGTGGCTCTC
GGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCCGCCCCTGCTTGACCGGAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCA
ACGGTGTCGCGGGAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCCACTCCGAGAACTCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCG
AAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGATGATGAATACATACCGTACCC
GCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCAGGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGGGCAAACCTCACACGAAGATCACGCTGG
TCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGCGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAG
AACTCCATGTGGGACAGTTCTCGGGTATAGCCCAGGGGTATCCCCAAACACGATAGAGACCACCCCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTC
CTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCACGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATG
CCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTCTAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTG
AGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCCCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCGA
GACCTCCCGGGGCTCAACAATGGCACCCTCCTCTTCCTCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGCCGAAGAGACTCTGATAGGAGCGTCGA
GTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGG
CAATCGAGAGACGTTTGCGAGGACTCCCTTCCTCATCGCCACCGGCTTTGGGAGTGCCCTTAGCCTTAACGGCCGGACTCTCAGAGCACACAGAGGTCCT
GGGACTGTGATCACCGTGATCACTAGCGGACGACTGCACGCTGTCTTCTTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCA
TCATGAGTGCTCTCGGACTCGGCATCGTCCTCACTGCCCGAGTTGAACTCACGTTCTACGAGCCGAGGGTTCGGACGATTGTCTGAAGACGAGGGCGACG
GACTGCGGCGCCTGCTTGCGCGCTTGTCCGCAGCCGCGTCACCCGAGGATCCGATCGCCTCGAAGGCCACCTGAGTAGCCTCTTTAAGTGCAGAGCCTTT
GCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTACCGGCTGCAGCCTTGGAGCGTGTCTTAGCACCGCTCTTAGCAGTGCCACGAGGCATGTTAACGGTC
GAAGTGGAGACCTTGACGAAGAGCGCACAGGTTGCTGCTCGAGGCTCTAACTGTAAAGTGAGCCTCCGCCGCGCTCGCGCGCCGAGTCGATGGTTTTTCG
ACTTTGAGAATGAGAGTTTGTGACGAACATCTCTTCATTTTGATTGGTCGGTAAACCGAACCTAAGTGGGGAGGATGTACGGGGTACGTAGCACTAAGTG
TACCCTTGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACATGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCATTCAAACCAACC
ATTGGTTAAATGACATTGCATTTCTATAGGTAACTGATAGTTTGTATTAACCACAAACTTAACCTACCTATAAATATACTCAGTTTACAATCTACCTTAT
TTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGT
GCTGTGTGACCCCGTCACAATTTGTTTTATCTGTGATTGAATTGCCATTTCAAAACGACAAAAAGGGTCGATTTACAGGATATCGATGTGGATTTGATGG
TTGATCGATCCCGAGCGGTCGATTTGGCTGTCGTAGCTCGGTTTCAATTTGAACTTTTTAAAGACCTCGGTTAAATAAAACAATCTCTATTAAATATTAT
TATTACTATTTTAAATTTTATTATAAATCGAGCATCAGGCTAAGTGAAAAAGACAATAGCATTGAAATGCACAATAACACATATGATGCATCCTTAGCGC
AAACATCAAATCTGAATAGTATGCGTGCTGTCAAATATCATCACGTACGCTAAATTATTATTAATAACGCCTTCAGAAAGTTCATCTTCACGGCTTCTTC
ATTCGAAAACCTCACAGACTACATGAATATTCCTTCTCTCTTAGCCCAAGGATCACTCATTTGCACATTCGCCACCGTCTCCTGCAGCAAACTCCCGTAG
GCAGTTCCAGTGTTGTGGCCTCACCGAAAACTGTAGAAACAGCTTCATTCAGCTGTCAATAAACAAAGTCCCTAATGTGTCGATCTACAGTATGCGAATT
CTTCTGCTTGAGGTGTTTTTCTAAT