Description :
From Genome Similarity Track
Location :
Scaffold_3642:606- 2480
Sequence
1874 bases(100 bases per row)
CAGGTCCTCTTCTGGCGTCGTACCACTTGGATTCCTTTGTGGATCCGATATCTCTCGGGCCAGAGCTTGTTGGATTTCTATCCGGACAGCTGGAGTGGTT
ATCGCAGCGAAATCTACCTCTCTCAATTCATACAATACCGCGGCAAACAGGGCGTAATCCTCGATGAACCGACTGTAGTAGTTCAAACTTCCCAAGAAGG
ATTGCATCGCCCGTATAGACTGTGGGAAGGACAAATCGGCTAACGAAGACAGGTCCTTTGGATTCGCCTCCAATCCCTCCTTGGAAACTCGATGGCCTAA
GTACTCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGTACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAAC
TGATCCCACGATTCCGCCGGGATCAGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGATGGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATG
GATCCACTTCCGTATGGCCTTCCCCAGACCCACTTGTTTCGGACTTCGGTATTCGGGTGAATCCATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTG
GGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAATGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACC
ACCCAGAAACCACTGGCCATGTCTAGAGAACAGTATCAGAGTACTTTATCCAGATCTTCCAACAGCTCGTTGATTAGGGGCATCGGATACACCATCAATC
GAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTTTTCTTGATGATGATTACCACTGGGGATGCCCACGGGGACGTCGA
GAAACTGATGATCTTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCCCGGAACTGAGGTGCCACCTTCCGCACCCTCTGAGCGATCGGTTTC
GCGTCGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAACGCATTACCTTTACCAATCAGCAGATGTCGGCTCTCCCAGATTTTCTGAC
GCAGACGATCCACTTCAGCAGGTTCATTCGCCCCTGGATCCACTTGGATATCATCAATCGTGACCTCTTCTGTGGTCAGTGGTACCTCCGAAATCACCGC
CATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCTTCACGGTAGCAGACTTGCTCATCTTCCGTCTTCGTAGGATCCACCATTGGATCCAAACAC
CGCGACCCTCTTTCGCCTGGCAGTCCTTCTGTCTTCGGGGGATCAGGTACCCTGGTATCAGGAAAACCACAAGTTGGATCTAGTCGGTCCTCTAACGAGT
TTAAGCCCGACAGTTCGGGTTTGACTAGTGTTGCCACTCTCGATAGGGATCCAGGCACTTTATCCAATGGAGAGCTTGGATCCACTTGTGGATCAGCGGG
ATCCGGCTGCTCGGCTTTAGCCCTCTGCAATCCTTCATCCACCGACCCTGCGTTATCTAAGGGCCGACTCTGGGGATCGTCCCCCGTCCTGGATCCAACT
TCCATTGCTTGGATCTCAACCCGTCGATCCCTCTGCAGGATCTTTCGCGGAGTTGGATATGAAGGCCGATCCACCAAGGGGCCAGTGGCTCCGCCGGGAG
CTCCACCTCTCCGAGGGATTCGATCTCGGTAGTCGCCTCGTACACCAGATTCTGCCATTCTTTGTAGCGGCGGGATCCCACTGACACATATCCAGGTCGC
CTAGGGATACCGTCCTTCGCCAACCATCGTCCGATCTCCTCATAATGGTCCAGTAATAGTCTCTTGTCGCTGAC