Description :
From Genome Similarity Track
Location :
Scaffold_682:6058- 7658
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_682-fgenesh-gene-0.4R3h domain containing protein

Sequence
1600 bases(100 bases per row)
TCATTTACCAAGTGgCGGAAAGTCTTCATTGTATGCTCCAGATCCCGAGCCccGCCGATTGAGCTGGTGAGGGAGAGAAGTAGGCTGTGGTGCACCCGCT
GTGTTGTAGCCGCCTcGCCCATGAGGTGAGTAGGGTGAGTGGTAAGCACCGCCTGATGGTGGAGGTGGAGGCCGCACTCcGCCGGTATGTGGAGAGGTCT
GTCGATAATATTCAGATGGAGGAGGCGGTGGGGgTGGGCCTCCTTGACGCTGCATGGTGGTGTCTATCCGGTTGTAGTCGTGCGGAGGAGGTGGAGGACC
CCGACCACGGCCAGGGTACGGAGGCTGTGCGGCACTCTGGTAGCCGTACGATCGTGGTCCGTCGTAATAGTACCCGTGATGGCCGCCACCAGCGAATCTC
TGGTTGTTCCCtCCGCCGTAATACCCgCCAGTCCCATTGCTGGATTGCTGATCTCGTGACGGACGGTATGCGTCGTGATTCCGGGTGAAGTCGGGATCGT
TCAGCTCTTGCTCACGGTTGCGCCATAGCACCTTACTCTCTTTCCAGTTCTGCTGCGGTTTCGCGTTACTGCTGTCGCTTCGGCCGCTCaCTGGTGAGCC
AGTCGACGATTTGGCCACCGCAGAAGGTGACTCCGACTGTTTGGCGCTTGCGCCATTACCTCGTCCGCCTCGTGCGAAACCACGACTTCCGTCTGgCCcA
GACGCCTGCTGTGCACCTCctAACTTCGGTGCACACGGGGACGAGCCGCTCTTTCCGGAGCCCGCGTTCTCAGACGATGACGACTCGGATTGCGAGCCGT
CTTCGCCAAAGATACGAGCACGGGCTTCGGCGTAGGCACGCTCACGGTCTTCAATAGAGCGTTGCTGGTtCTTTGCATCCATCCCAGCGCCTCGTCCGGC
GGCCCCGTTTGGAGCTCCTCGTGGAGGCGCTCGCTTGCGCATCATGATCTTGGGTGCCGgCGCTGGCGTGACGGTCTGCTGCTGCTTGTCGGCCGACAAa
TCGATTAGCAGCACGCGTGGGATGCTTGTGTGCTGCGTCTTgAaGAGCGTGACGACTCGCGAGGCATTaCCATCGTAGCCCTGCGCATATGGGTTGTAGT
CGCCTGTCTGGTGCTCGAGTCCGCACCGGTCTGCGAGTCGGTGGATGATCAGTCGATGATACGACGacAGCGGTGGGAACACGAGCTGCGACTCGCGCGA
GCTCTTGATGAAGCGCACGATCTGATCCTCGAACTTGAGCAGCGTTAGTCGCTCGCGCGCGTTCTCGAGCCCCGCGAGCAGCACGGGGTCCAGCGGCCCG
AAGCGCGCGACCGCGGCCGTGGCGGTCGCCGGGCTCACCGACTGCGCATACTCGGCGTTCGGGTCAAACAGCGCATGGGAAGgTGACGGCTGCGTCTGGC
GCCGGAAcGGGTCGgCGCTATCAAACGTGCCACCATCTTGCGACGGCGCAGGCGGCACGAGCCGGAGCCCTCcgAACGtCGTCGCGGCGTCGGCCATCTC
GTCGCTGTCGCTGGACTCGGACGCAGGTGCTGGCGCtGGTGCTGGTGCAGACGCAGGCGTCGCCACCACGCGCGGGaGCTCGCGCGTCTCCCAGTCGTCG